• IL16 Chimpanzee  cDNA/ORF Clone

IL16 Chimpanzee cDNA/ORF Clone

Cat.#: 732609-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 959.0 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    interleukin 16
  • Organism
    Chimpanzee
  • Entrez Gene ID
  • Gene Symbol
    IL16
  • Gene Type
    protein coding
  • Encoded Protein Alias
    Interleukin-16; interleukin 16 (lymphocyte chemoattractant factor)
  • Product Name
    IL16(NM_001009028) Chimpanzee cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Pan troglodytes interleukin 16 (IL16), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1896
  • Annotation
    This variant (2) has multiple differences, compared to variant 1. These differences result in a distinct 5' UTR and cause translation initiation at a downstream start codon, compared to variant 1. The encoded protein (isoform 2) is shorter than isoform 1.
  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"