Cart 2
  • RIMS2 Human  cDNA/ORF Clone

RIMS2 Human cDNA/ORF Clone

Cat.#: 757667-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 294.0 USD

Availability: 1 week
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    regulating synaptic membrane exocytosis 2
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    RIMS2
  • Gene Type
    protein coding
  • Also Known as
    OBOE; RIM2; RAB3IP3
  • Product Name
    RIMS2(NM_014677) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    3492
  • Annotation
    This variant (2) differs in the 5' UTR, and has multiple differences in the presence and absence of exons in the 5' and mid-coding regions, compared to variant 1. The resulting protein (isoform b) is shorter and has a distinct N-terminus, compared to isoform a.
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014045) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X44, mRNA.
  • Synonyms
  • ORF length
    3426
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014031) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X30, mRNA.
  • Synonyms
  • ORF length
    4185
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014037) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X36, mRNA.
  • Synonyms
  • ORF length
    4014
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014021) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X19, mRNA.
  • Synonyms
  • ORF length
    4512
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014015) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    4740
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014010) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    4878
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_011517395) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    5133
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014046) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X45, mRNA.
  • Synonyms
  • ORF length
    3246
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014025) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X24, mRNA.
  • Synonyms
  • ORF length
    4317
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014013) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    4824
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014014) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    4770
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014019) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X17, mRNA.
  • Synonyms
  • ORF length
    4638
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014007) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    5028
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014035) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X34, mRNA.
  • Synonyms
  • ORF length
    4080
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014030) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X29, mRNA.
  • Synonyms
  • ORF length
    4209
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014039) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X38, mRNA.
  • Synonyms
  • ORF length
    4002
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014044) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X43, mRNA.
  • Synonyms
  • ORF length
    3474
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014029) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X28, mRNA.
  • Synonyms
  • ORF length
    4221
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014041) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X40, mRNA.
  • Synonyms
  • ORF length
    3828
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_005251107) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X15, mRNA.
  • Synonyms
  • ORF length
    4659
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(NM_001100117) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    4050
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest isoform (a).
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(NM_001282881) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    3567
  • Annotation
    This variant (3) uses an alternate 5' structure compared to variant 1. The encoded isoform (c) is shorter and has a distinct N-terminus compared to isoform 1.
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(NM_001282882) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    858
  • Annotation
    This variant (4) uses an alternate 5' structure compared to variant 1. The encoded isoform (d) is shorter and has a distinct N-terminus compared to isoform 1.
  • siRNA
  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014042) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X41, mRNA.
  • Synonyms
  • ORF length
    3822
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014006) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    5118
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_005251106) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X13, mRNA.
  • Synonyms
  • ORF length
    4725
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_011517398) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X21, mRNA.
  • Synonyms
  • ORF length
    4431
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014012) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    4833
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014034) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X33, mRNA.
  • Synonyms
  • ORF length
    4128
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014028) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X27, mRNA.
  • Synonyms
  • ORF length
    4224
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014032) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X31, mRNA.
  • Synonyms
  • ORF length
    4176
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014011) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    4866
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014043) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X42, mRNA.
  • Synonyms
  • ORF length
    3633
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014023) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X22, mRNA.
  • Synonyms
  • ORF length
    4416
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014026) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X25, mRNA.
  • Synonyms
  • ORF length
    4263
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014022) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X20, mRNA.
  • Synonyms
  • ORF length
    4434
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014040) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X39, mRNA.
  • Synonyms
  • ORF length
    3975
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014027) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X26, mRNA.
  • Synonyms
  • ORF length
    4242
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014038) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X37, mRNA.
  • Synonyms
  • ORF length
    4002
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014008) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    5019
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014017) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X14, mRNA.
  • Synonyms
  • ORF length
    4692
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014036) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X35, mRNA.
  • Synonyms
  • ORF length
    4074
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014018) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X16, mRNA.
  • Synonyms
  • ORF length
    4650
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014033) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X32, mRNA.
  • Synonyms
  • ORF length
    4134
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014009) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    4914
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014016) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X12, mRNA.
  • Synonyms
  • ORF length
    4725
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014024) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X23, mRNA.
  • Synonyms
  • ORF length
    4365
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    RIMS2(XM_017014020) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X18, mRNA.
  • Synonyms
  • ORF length
    4563
  • siRNA

    CUACCGAAGUGAUCCGAAUtt

    GCGAAUACCUGAUAGCACAtt

    CCAACACGGAGGUUGCAAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"