NovoPro
Cart 2
  • REV3L Human  cDNA/ORF Clone

REV3L Human cDNA/ORF Clone

Cat.#: 754739-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    REV3 like, DNA directed polymerase zeta catalytic subunit
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    REV3L
  • Gene Type
    protein coding
  • Also Known as
    POLZ; REV3
  • Product Name
    REV3L(NM_001286432) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens REV3 like, DNA directed polymerase zeta catalytic subunit (REV3L), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    9159
  • Annotation
    This variant (2) differs in its 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to isoform a. Both variants 2 and 3 encode isoform b.
  • siRNA

    CUAGUGAUAUCUCCAAUUAtt

    GACUGUUAAUUCUCGUAUAtt

    GGUCUAACUCAAUAAUGGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    REV3L(NM_002912) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens REV3 like, DNA directed polymerase zeta catalytic subunit (REV3L), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    9393
  • Annotation
    This variant (1) encodes the longer isoform (a).
  • siRNA

    CUAGUGAUAUCUCCAAUUAtt

    GACUGUUAAUUCUCGUAUAtt

    GGUCUAACUCAAUAAUGGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    REV3L(XM_011536036) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens REV3 like, DNA directed polymerase zeta catalytic subunit (REV3L), transcript variant X15, mRNA.
  • Synonyms
  • ORF length
    6987
  • siRNA

    CUAGUGAUAUCUCCAAUUAtt

    GACUGUUAAUUCUCGUAUAtt

    GGUCUAACUCAAUAAUGGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    REV3L(XM_011536030) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens REV3 like, DNA directed polymerase zeta catalytic subunit (REV3L), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    9396
  • siRNA

    CUAGUGAUAUCUCCAAUUAtt

    GACUGUUAAUUCUCGUAUAtt

    GGUCUAACUCAAUAAUGGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    REV3L(XM_017011155) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens REV3 like, DNA directed polymerase zeta catalytic subunit (REV3L), transcript variant X16, mRNA.
  • Synonyms
  • ORF length
    6765
  • siRNA

    CUAGUGAUAUCUCCAAUUAtt

    GACUGUUAAUUCUCGUAUAtt

    GGUCUAACUCAAUAAUGGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    REV3L(XM_011536029) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens REV3 like, DNA directed polymerase zeta catalytic subunit (REV3L), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    9471
  • siRNA

    CUAGUGAUAUCUCCAAUUAtt

    GACUGUUAAUUCUCGUAUAtt

    GGUCUAACUCAAUAAUGGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    REV3L(XM_011536028) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens REV3 like, DNA directed polymerase zeta catalytic subunit (REV3L), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    9474
  • siRNA

    CUAGUGAUAUCUCCAAUUAtt

    GACUGUUAAUUCUCGUAUAtt

    GGUCUAACUCAAUAAUGGAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"