NovoPro
Cart 2
  • PTPRZ1 Human  cDNA/ORF Clone

PTPRZ1 Human cDNA/ORF Clone

Cat.#: 755002-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    protein tyrosine phosphatase, receptor type Z1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    PTPRZ1
  • Gene Type
    protein coding
  • Also Known as
    PTPZ; HPTPZ; PTP18; PTPRZ; RPTPB; HPTPzeta; PTP-ZETA; RPTPbeta; phosphacan; R-PTP-zeta-2
  • Product Name
    PTPRZ1(XM_017012477) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens protein tyrosine phosphatase, receptor type Z1 (PTPRZ1), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    6906
  • siRNA

    GGAUGAUAUGGGACCAUAAtt

    GCUUAUACAUUCCGAUGAAtt

    GCGACCAACUGAUUGUCGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PTPRZ1(NM_001206839) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens protein tyrosine phosphatase, receptor type Z1 (PTPRZ1), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    4347
  • Annotation
    This variant (3) uses an alternate in-frame donor splice site at an internal coding exon, and is lacking another in-frame coding exon compared to variant 1. This results in a shorter isoform (2) missing two internal protein segments compared to isoform 1.
  • siRNA

    GGAUGAUAUGGGACCAUAAtt

    GCGACCAACUGAUUGUCGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PTPRZ1(NM_002851) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens protein tyrosine phosphatase, receptor type Z1 (PTPRZ1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    6948
  • Annotation
    This variant (1) encodes the longest isoform (1).
  • siRNA

    GGAUGAUAUGGGACCAUAAtt

    GCUUAUACAUUCCGAUGAAtt

    GCGACCAACUGAUUGUCGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PTPRZ1(NM_001206838) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens protein tyrosine phosphatase, receptor type Z1 (PTPRZ1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    4368
  • Annotation
    This variant (2) uses an alternate in-frame donor splice site at an internal coding exon compared to variant 1. This results in a shorter isoform (2) missing an internal protein segment compared to isoform 1.
  • siRNA

    GGAUGAUAUGGGACCAUAAtt

    GCGACCAACUGAUUGUCGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PTPRZ1(XM_005250519) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens protein tyrosine phosphatase, receptor type Z1 (PTPRZ1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    6927
  • siRNA

    GGAUGAUAUGGGACCAUAAtt

    GCUUAUACAUUCCGAUGAAtt

    GCGACCAACUGAUUGUCGAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"