NovoPro
Cart 2
  • PTPN13 Human  cDNA/ORF Clone

PTPN13 Human cDNA/ORF Clone

Cat.#: 754946-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    protein tyrosine phosphatase, non-receptor type 13
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    PTPN13
  • Gene Type
    protein coding
  • Also Known as
    PNP1; FAP-1; PTP1E; PTPL1; PTPLE; PTP-BL; hPTP1E; PTP-BAS
  • Product Name
    PTPN13(NM_080685) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens protein tyrosine phosphatase, non-receptor type 13 (PTPN13), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    7473
  • Annotation
    This variant (4) encodes the longest isoform (4).
  • siRNA

    CUAGUUCGAUGGAUAAGUAtt

    GGAUGUUAUUUACGCUCGAtt

    GUAUGGAGAUUAUCAACCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PTPN13(XM_017008516) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens protein tyrosine phosphatase, non-receptor type 13 (PTPN13), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    6951
  • siRNA

    CUAGUUCGAUGGAUAAGUAtt

    GGAUGUUAUUUACGCUCGAtt

    GUAUGGAGAUUAUCAACCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PTPN13(NM_080683) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens protein tyrosine phosphatase, non-receptor type 13 (PTPN13), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    7458
  • Annotation
    This variant (1) lacks an in-frame segment of a coding exon, compared to variant 4. The encoded protein (isoform 1) lacks 5 internal amino acids, compared to isoform 4.
  • siRNA

    CUAGUUCGAUGGAUAAGUAtt

    GGAUGUUAUUUACGCUCGAtt

    GUAUGGAGAUUAUCAACCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PTPN13(XM_017008512) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens protein tyrosine phosphatase, non-receptor type 13 (PTPN13), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    7467
  • siRNA

    CUAGUUCGAUGGAUAAGUAtt

    GGAUGUUAUUUACGCUCGAtt

    GUAUGGAGAUUAUCAACCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PTPN13(XM_017008515) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens protein tyrosine phosphatase, non-receptor type 13 (PTPN13), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    6963
  • siRNA

    CUAGUUCGAUGGAUAAGUAtt

    GGAUGUUAUUUACGCUCGAtt

    GUAUGGAGAUUAUCAACCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PTPN13(XM_011532165) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens protein tyrosine phosphatase, non-receptor type 13 (PTPN13), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    7524
  • siRNA

    CUAGUUCGAUGGAUAAGUAtt

    GGAUGUUAUUUACGCUCGAtt

    GUAUGGAGAUUAUCAACCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PTPN13(NM_006264) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens protein tyrosine phosphatase, non-receptor type 13 (PTPN13), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    7401
  • Annotation
    This variant (2) lacks multiple in-frame segments of the coding region, compared to variant 4. The encoded protein (isoform 2) lacks 19 internal amino acids, compared to isoform 4.
  • siRNA

    CUAGUUCGAUGGAUAAGUAtt

    GGAUGUUAUUUACGCUCGAtt

    GUAUGGAGAUUAUCAACCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PTPN13(XM_017008511) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens protein tyrosine phosphatase, non-receptor type 13 (PTPN13), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    7509
  • siRNA

    CUAGUUCGAUGGAUAAGUAtt

    GGAUGUUAUUUACGCUCGAtt

    GUAUGGAGAUUAUCAACCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PTPN13(XM_017008514) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens protein tyrosine phosphatase, non-receptor type 13 (PTPN13), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    7416
  • siRNA

    CUAGUUCGAUGGAUAAGUAtt

    GGAUGUUAUUUACGCUCGAtt

    GUAUGGAGAUUAUCAACCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PTPN13(NM_080684) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens protein tyrosine phosphatase, non-receptor type 13 (PTPN13), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    6885
  • Annotation
    This variant (3) lacks multiple in-frame segments of the coding region, compared to variant 4. The encoded protein (isoform 3) lacks 191 internal amino acids, compared to isoform 4.
  • siRNA

    CUAGUUCGAUGGAUAAGUAtt

    GGAUGUUAUUUACGCUCGAtt

    GUAUGGAGAUUAUCAACCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PTPN13(XM_017008513) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens protein tyrosine phosphatase, non-receptor type 13 (PTPN13), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    7452
  • siRNA

    CUAGUUCGAUGGAUAAGUAtt

    GGAUGUUAUUUACGCUCGAtt

    GUAUGGAGAUUAUCAACCAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"