NovoPro
Cart 2
  • PPIP5K2 Human  cDNA/ORF Clones

PPIP5K2 Human cDNA/ORF Clones

Cat.#: 767724-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 820.8 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    diphosphoinositol pentakisphosphate kinase 2
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    PPIP5K2
  • Gene Type
    protein coding
  • Also Known as
    VIP2; IP7K2; CFAP160; HISPPD1
  • Product Name
    PPIP5K2(XM_005277541) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens diphosphoinositol pentakisphosphate kinase 2 (PPIP5K2), transcript variant X16, mRNA.
  • Synonyms
  • ORF length
    3420
  • siRNA

    GGAUGAACAGUGGAAACGAtt

    CCUAAUACCUCAUCUCGGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PPIP5K2(XM_005277535) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens diphosphoinositol pentakisphosphate kinase 2 (PPIP5K2), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    3774
  • siRNA

    GGAUUAUGCUCGUACUCAUtt

    GGAUGAACAGUGGAAACGAtt

    CCUAAUACCUCAUCUCGGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PPIP5K2(XM_005277539) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens diphosphoinositol pentakisphosphate kinase 2 (PPIP5K2), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    3594
  • siRNA

    GGAUGAACAGUGGAAACGAtt

    CCUAAUACCUCAUCUCGGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PPIP5K2(XM_006714577) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens diphosphoinositol pentakisphosphate kinase 2 (PPIP5K2), transcript variant X14, mRNA.
  • Synonyms
  • ORF length
    3483
  • siRNA

    GGAUGAACAGUGGAAACGAtt

    CCUAAUACCUCAUCUCGGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PPIP5K2(NM_015216) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens diphosphoinositol pentakisphosphate kinase 2 (PPIP5K2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    3669
  • Annotation
    This variant (2) lacks three internal exons in the coding region, but maintains the reading frame, compared to variant 4. The resulting isoform (2) lacks two internal segments, compared to isoform 3.
  • siRNA

    GGAUUAUGCUCGUACUCAUtt

    GGAUGAACAGUGGAAACGAtt

    CCUAAUACCUCAUCUCGGAtt

  • DataSheet:
  • FAQs:
  • DataSheet:
  • FAQs:
  • Product Name
    PPIP5K2(XM_006714576) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens diphosphoinositol pentakisphosphate kinase 2 (PPIP5K2), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    3657
  • siRNA

    GGAUGAACAGUGGAAACGAtt

    CCUAAUACCUCAUCUCGGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PPIP5K2(NM_001276277) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens diphosphoinositol pentakisphosphate kinase 2 (PPIP5K2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    3732
  • Annotation
    This variant (1) lacks two in-frame exons in the coding region, compared to variant 4. The resulting isoform (1) lacks two internal segments, compared to isoform (3).
  • siRNA

    GGAUUAUGCUCGUACUCAUtt

    GGAUGAACAGUGGAAACGAtt

    CCUAAUACCUCAUCUCGGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PPIP5K2(NM_001281471) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens diphosphoinositol pentakisphosphate kinase 2 (PPIP5K2), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    3837
  • Annotation
    This variant (4) represents the longest transcript and encodes the longest isoform (3).
  • siRNA

    GGAUUAUGCUCGUACUCAUtt

    GGAUGAACAGUGGAAACGAtt

    CCUAAUACCUCAUCUCGGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PPIP5K2(XM_005277534) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens diphosphoinositol pentakisphosphate kinase 2 (PPIP5K2), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    3777
  • siRNA

    GGAUUAUGCUCGUACUCAUtt

    GGAUGAACAGUGGAAACGAtt

    CCUAAUACCUCAUCUCGGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PPIP5K2(XM_005277536) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens diphosphoinositol pentakisphosphate kinase 2 (PPIP5K2), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    3714
  • siRNA

    GGAUUAUGCUCGUACUCAUtt

    GGAUGAACAGUGGAAACGAtt

    CCUAAUACCUCAUCUCGGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PPIP5K2(XM_017009273) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens diphosphoinositol pentakisphosphate kinase 2 (PPIP5K2), transcript variant X13, mRNA.
  • Synonyms
  • ORF length
    3492
  • siRNA

    GGAUUAUGCUCGUACUCAUtt

    GGAUGAACAGUGGAAACGAtt

    CCUAAUACCUCAUCUCGGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PPIP5K2(XM_017009274) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens diphosphoinositol pentakisphosphate kinase 2 (PPIP5K2), transcript variant X15, mRNA.
  • Synonyms
  • ORF length
    3438
  • siRNA

    GGAUGAACAGUGGAAACGAtt

    CCUAAUACCUCAUCUCGGAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"