NovoPro
Cart 2
  • PI4KA Human  cDNA/ORF Clone

PI4KA Human cDNA/ORF Clone

Cat.#: 756790-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    phosphatidylinositol 4-kinase alpha
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    PI4KA
  • Gene Type
    protein coding
  • Also Known as
    PIK4CA; PMGYCHA; pi4K230; PI4K-ALPHA
  • Product Name
    PI4KA(XM_017028829) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens phosphatidylinositol 4-kinase alpha (PI4KA), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    6327
  • siRNA

    GCGGCUGCGUGAAGACAUAtt

    CAGUGGAAGGACAACGUGAtt

    GGCUAUGUGCGGGAGUAUAtt

    GACUAACAUUUAUCUAGAUtt

    CAGUUCAUCUGGAACAUGAtt

    CUACCUGUCUUAUUUCAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PI4KA(NM_058004) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens phosphatidylinositol 4-kinase alpha (PI4KA), mRNA.
  • Synonyms
  • ORF length
    6309
  • siRNA

    GCGGCUGCGUGAAGACAUAtt

    CAGUGGAAGGACAACGUGAtt

    GGCUAUGUGCGGGAGUAUAtt

    GACUAACAUUUAUCUAGAUtt

    CAGUUCAUCUGGAACAUGAtt

    CUACCUGUCUUAUUUCAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PI4KA(XM_005261634) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens phosphatidylinositol 4-kinase alpha (PI4KA), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    6300
  • siRNA

    GCGGCUGCGUGAAGACAUAtt

    CAGUGGAAGGACAACGUGAtt

    GGCUAUGUGCGGGAGUAUAtt

    GACUAACAUUUAUCUAGAUtt

    CAGUUCAUCUGGAACAUGAtt

    CUACCUGUCUUAUUUCAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PI4KA(XM_017028830) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens phosphatidylinositol 4-kinase alpha (PI4KA), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    4410
  • siRNA

    GCGGCUGCGUGAAGACAUAtt

    CAGUGGAAGGACAACGUGAtt

    GGCUAUGUGCGGGAGUAUAtt

    GACUAACAUUUAUCUAGAUtt

    CAGUUCAUCUGGAACAUGAtt

    CUACCUGUCUUAUUUCAUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"