NovoPro
Cart 2
  • PCDHA5 Human  cDNA/ORF Clones

PCDHA5 Human cDNA/ORF Clones

Cat.#: 752769-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 420.1 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    protocadherin alpha 5
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    PCDHA5
  • Gene Type
    protein coding
  • Also Known as
    CNR6; CNRN6; CNRS6; CRNR6; PCDH-ALPHA5
  • Product Name
    PCDHA5(NM_031501) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens protocadherin alpha 5 (PCDHA5), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2451
  • Annotation
    This variant (2) utilizes the large, first exon then continues into the downstream intron 1 sequence before terminating. This one-exon transcript encodes a shorter isoform (2), compared to isoform 1. This short variant is represented based on data in PMID:10380929.
  • siRNA

    GACUAUAACUCAUAUGAAAtt

    GGACAUUAGUUAUUAAACUtt

    CAGUAUACCGUGUUCGUGAtt

    GCACAAUUGAGAUACAGGUtt

    GGUUAAAUCCAAACGAAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    PCDHA5(NM_018908) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens protocadherin alpha 5 (PCDHA5), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2811
  • Annotation
    This variant (1) includes the constant region exons and encodes the longest isoform (1).
  • siRNA

    GACUAUAACUCAUAUGAAAtt

    GGACAUUAGUUAUUAAACUtt

    CAGUAUACCGUGUUCGUGAtt

    GCACAAUUGAGAUACAGGUtt

    GGUUAAAUCCAAACGAAUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"