NovoPro
Cart 2
  • DROSHA Human  cDNA/ORF Clone

DROSHA Human cDNA/ORF Clone

Cat.#: 754065-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 941.0 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    drosha ribonuclease III
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    DROSHA
  • Gene Type
    protein coding
  • Also Known as
    RN3; ETOHI2; RNASEN; RANSE3L; RNASE3L; HSA242976
  • Product Name
    DROSHA(XM_005248294) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens drosha ribonuclease III (DROSHA), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    3921
  • siRNA

    GCUCUGUCCGUAUCGAUCAtt

    GACCAGACUUUGUACCCUUtt

    CACUUAACUUUGUUGCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DROSHA(XM_011514033) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens drosha ribonuclease III (DROSHA), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    3753
  • siRNA

    GCUCUGUCCGUAUCGAUCAtt

    GACCAGACUUUGUACCCUUtt

    CACUUAACUUUGUUGCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DROSHA(XM_017009401) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens drosha ribonuclease III (DROSHA), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    3897
  • siRNA

    GCUCUGUCCGUAUCGAUCAtt

    GACCAGACUUUGUACCCUUtt

    CACUUAACUUUGUUGCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DROSHA(NM_013235) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens drosha ribonuclease III (DROSHA), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    4125
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • siRNA

    GCUCUGUCCGUAUCGAUCAtt

    GACCAGACUUUGUACCCUUtt

    CACUUAACUUUGUUGCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DROSHA(XM_005248293) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens drosha ribonuclease III (DROSHA), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    4032
  • siRNA

    GCUCUGUCCGUAUCGAUCAtt

    GACCAGACUUUGUACCCUUtt

    CACUUAACUUUGUUGCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DROSHA(NM_001100412) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens drosha ribonuclease III (DROSHA), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    4014
  • Annotation
    This variant (2) differs in the 5' UTR and lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. The resulting protein (isoform 2) is shorter than isoform 1.
  • siRNA

    GCUCUGUCCGUAUCGAUCAtt

    GACCAGACUUUGUACCCUUtt

    CACUUAACUUUGUUGCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DROSHA(XM_017009400) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens drosha ribonuclease III (DROSHA), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    3990
  • siRNA

    GCUCUGUCCGUAUCGAUCAtt

    GACCAGACUUUGUACCCUUtt

    CACUUAACUUUGUUGCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DROSHA(XM_005248292) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens drosha ribonuclease III (DROSHA), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    4101
  • siRNA

    GCUCUGUCCGUAUCGAUCAtt

    GACCAGACUUUGUACCCUUtt

    CACUUAACUUUGUUGCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DROSHA(XM_017009399) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens drosha ribonuclease III (DROSHA), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    4008
  • siRNA

    GCUCUGUCCGUAUCGAUCAtt

    GACCAGACUUUGUACCCUUtt

    CACUUAACUUUGUUGCGAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"