NovoPro
Cart 2
  • DMXL1 Human  cDNA/ORF Clone

DMXL1 Human cDNA/ORF Clone

Cat.#: 762026-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    Dmx like 1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    DMXL1
  • Gene Type
    protein coding
  • Product Name
    DMXL1(NM_005509) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens Dmx like 1 (DMXL1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    9084
  • Annotation
    This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
  • siRNA

    CACUUGCUCUUGUAGCACAtt

    CUGUAGGAAUUGGAUCAAAtt

    CAUCGUCAGUCAACAAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    DMXL1(NM_001290322) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens Dmx like 1 (DMXL1), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    8565
  • Annotation
    This variant (3) differs in the 5' UTR, has multiple differences in the coding region, and uses a downstream start codon compared to variant 1. The encoded isoform (3) has a shorter N-terminus and lacks an internal segment compared to isoform 1.
  • siRNA

    CACUUGCUCUUGUAGCACAtt

    CUGUAGGAAUUGGAUCAAAtt

    CAUCGUCAGUCAACAAUCAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"