NovoPro
Cart 2
  • CACNB2 Human  cDNA/ORF Clone

CACNB2 Human cDNA/ORF Clone

Cat.#: 761685-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 319.2 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    calcium voltage-gated channel auxiliary subunit beta 2
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CACNB2
  • Gene Type
    protein coding
  • Also Known as
    MYSB; CAVB2; CACNLB2
  • Product Name
    CACNB2(NM_201571) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium voltage-gated channel auxiliary subunit beta 2 (CACNB2), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    1899
  • Annotation
    This variant (6) uses an alternate 5' terminal exon and therefore differs in the 5' UTR and 5' coding region, compared to variant 2. These differences cause translation initiation at an alternate start codon, and result in an isoform (6) with a shorter and distinct N-terminus, compared to isoform 2.
  • siRNA

    GGGAAAUUCUACUCCAGUAtt

    CAUUUGCGGUUCGGACAAAtt

    GGUUUUACAAAGGUUAAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CACNB2(XM_005252588) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium voltage-gated channel auxiliary subunit beta 2 (CACNB2), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1725
  • siRNA

    GGGAAAUUCUACUCCAGUAtt

    CAUUUGCGGUUCGGACAAAtt

    GGUUUUACAAAGGUUAAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CACNB2(NM_001167945) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium voltage-gated channel auxiliary subunit beta 2 (CACNB2), transcript variant 9, mRNA.
  • Synonyms
  • ORF length
    1785
  • Annotation
    This variant (9) uses an alternate 5' terminal exon, lacks an alternate in-frame exon and contains an alternate in-frame exon in the 5' coding region, compared to variant 2. These differences cause translation initiation at an alternate start codon, and result in an isoform (9) with a shorter and distinct N-terminus, compared to isoform 2.
  • siRNA

    GGGAAAUUCUACUCCAGUAtt

    CAUUUGCGGUUCGGACAAAtt

    GGUUUUACAAAGGUUAAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CACNB2(NM_201593) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium voltage-gated channel auxiliary subunit beta 2 (CACNB2), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    1869
  • Annotation
    This variant (5) lacks an alternate in-frame exon and contains an alternate in-frame exon, in the 5' coding region, compared to variant 2. The encoded isoform (5) is shorter than isoform 2.
  • siRNA

    GGGAAAUUCUACUCCAGUAtt

    CAUUUGCGGUUCGGACAAAtt

    GGUUUUACAAAGGUUAAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CACNB2(NM_000724) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium voltage-gated channel auxiliary subunit beta 2 (CACNB2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1818
  • Annotation
    This variant (1) represents use of an alternate promoter and therefore differs in the 5' UTR and 5' coding region, compared to variant 2. These differences cause translation initiation at an alternate start codon, and result in an isoform (1) with a shorter and distinct N-terminus, compared to isoform 2.
  • siRNA

    GGGAAAUUCUACUCCAGUAtt

    CAUUUGCGGUUCGGACAAAtt

    GGUUUUACAAAGGUUAAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CACNB2(NM_201570) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium voltage-gated channel auxiliary subunit beta 2 (CACNB2), transcript variant 7, mRNA.
  • Synonyms
  • ORF length
    1839
  • Annotation
    This variant (7) represents use of an alternate promoter and therefore differs in the 5' UTR and 5' coding region, compared to variant 2. These differences cause translation initiation at an alternate start codon, and result in an isoform (7) with a shorter and distinct N-terminus, compared to isoform 2.
  • siRNA

    GGGAAAUUCUACUCCAGUAtt

    CAUUUGCGGUUCGGACAAAtt

    GGUUUUACAAAGGUUAAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CACNB2(XM_006717502) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium voltage-gated channel auxiliary subunit beta 2 (CACNB2), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1803
  • siRNA

    GGGAAAUUCUACUCCAGUAtt

    CAUUUGCGGUUCGGACAAAtt

    GGUUUUACAAAGGUUAAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CACNB2(NM_201596) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium voltage-gated channel auxiliary subunit beta 2 (CACNB2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1983
  • Annotation
    This variant (2) encodes the longest isoform (2).
  • siRNA

    GGGAAAUUCUACUCCAGUAtt

    CAUUUGCGGUUCGGACAAAtt

    GGUUUUACAAAGGUUAAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CACNB2(XM_011519659) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium voltage-gated channel auxiliary subunit beta 2 (CACNB2), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1749
  • siRNA

    GGGAAAUUCUACUCCAGUAtt

    CAUUUGCGGUUCGGACAAAtt

    GGUUUUACAAAGGUUAAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CACNB2(NM_201597) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium voltage-gated channel auxiliary subunit beta 2 (CACNB2), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    1911
  • Annotation
    This variant (4) lacks an alternate in-frame exon and contains an alternate in-frame exon, in the 5' coding region, compared to variant 2. The encoded isoform (4) is shorter than isoform 2.
  • siRNA

    GGGAAAUUCUACUCCAGUAtt

    CAUUUGCGGUUCGGACAAAtt

    GGUUUUACAAAGGUUAAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CACNB2(NM_001330060) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium voltage-gated channel auxiliary subunit beta 2 (CACNB2), transcript variant 10, mRNA.
  • Synonyms
  • ORF length
    1704
  • Annotation
    This variant (10) represents use of an alternate promoter, differs in the 5' UTR and 5' coding region, and uses an alternate internal in-frame exon compared to variant 2. These differences cause translation initiation at an alternate start codon and result in an isoform (10) that is shorter and has a distinct N-terminus compared to isoform 2.
  • siRNA
  • DataSheet:
  • FAQs:
  • Product Name
    CACNB2(NM_201572) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium voltage-gated channel auxiliary subunit beta 2 (CACNB2), transcript variant 8, mRNA.
  • Synonyms
  • ORF length
    1827
  • siRNA

    GGGAAAUUCUACUCCAGUAtt

    CAUUUGCGGUUCGGACAAAtt

    GGUUUUACAAAGGUUAAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CACNB2(NM_201590) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium voltage-gated channel auxiliary subunit beta 2 (CACNB2), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1821
  • Annotation
    This variant (3) represents use of an alternate promoter and therefore differs in the 5' UTR and 5' coding region, compared to variant 2. These differences cause translation initiation at an alternate start codon, and result in an isoform (3) with a shorter and distinct N-terminus, compared to isoform 2.
  • siRNA

    GGGAAAUUCUACUCCAGUAtt

    CAUUUGCGGUUCGGACAAAtt

    GGUUUUACAAAGGUUAAUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"