• ATRX Human  cDNA/ORF Clone

ATRX Human cDNA/ORF Clone

Cat.#: 760835-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    ATRX, chromatin remodeler
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    ATRX
  • Gene Type
    protein coding
  • Also Known as
    JMS; SHS; XH2; XNP; ATR2; SFM1; MRX52; RAD54; MRXHF1; RAD54L; ZNF-HX
  • Product Name
    ATRX(NM_138270) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens ATRX, chromatin remodeler (ATRX), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    7365
  • Annotation
    This variant (2) lacks a segment within the coding region when compared to variant 1. The translation remains in-frame, and thus results in an isoform (2) that lacks an internal segment, as compared to isoform 1.
  • siRNA

    CAAUGGUAUUGCUACAUUUtt

    AGAUAAAAGUUGACAGUGAtt

    CAGCGUAUUUGAGAAUUUAtt

    UGAUGAUCAGAAUUCUAUAtt

    CAAUGAUCCUGAGAAUAGAtt

    GAACAAGCACUAAAAGGAAtt

    GCGAAUACUUAUGAACAGAtt

    CCCUGUCAGCAAUGAGUAAtt

    GAGCUUGAUGUUAAACGAAtt

    CUAACCCUGUAACAUCUAAtt

    CCAAUGGUAUUGCUACAUUtt

    GUACCGGUGGUGAACAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATRX(XM_005262157) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ATRX, chromatin remodeler (ATRX), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    7275
  • siRNA

    CAAUGGUAUUGCUACAUUUtt

    AGAUAAAAGUUGACAGUGAtt

    CAGCGUAUUUGAGAAUUUAtt

    UGAUGAUCAGAAUUCUAUAtt

    CAAUGAUCCUGAGAAUAGAtt

    GAACAAGCACUAAAAGGAAtt

    GCGAAUACUUAUGAACAGAtt

    CCCUGUCAGCAAUGAGUAAtt

    GAGCUUGAUGUUAAACGAAtt

    CUAACCCUGUAACAUCUAAtt

    CCAAUGGUAUUGCUACAUUtt

    GUACCGGUGGUGAACAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATRX(XM_017029604) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ATRX, chromatin remodeler (ATRX), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    7278
  • siRNA

    CAAUGGUAUUGCUACAUUUtt

    AGAUAAAAGUUGACAGUGAtt

    CAGCGUAUUUGAGAAUUUAtt

    UGAUGAUCAGAAUUCUAUAtt

    CAAUGAUCCUGAGAAUAGAtt

    GAACAAGCACUAAAAGGAAtt

    GCGAAUACUUAUGAACAGAtt

    CCCUGUCAGCAAUGAGUAAtt

    GAGCUUGAUGUUAAACGAAtt

    CUAACCCUGUAACAUCUAAtt

    CCAAUGGUAUUGCUACAUUtt

    GUACCGGUGGUGAACAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATRX(XM_017029608) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ATRX, chromatin remodeler (ATRX), transcript variant X15, mRNA.
  • Synonyms
  • ORF length
    7197
  • siRNA

    CAAUGGUAUUGCUACAUUUtt

    AGAUAAAAGUUGACAGUGAtt

    CAGCGUAUUUGAGAAUUUAtt

    UGAUGAUCAGAAUUCUAUAtt

    CAAUGAUCCUGAGAAUAGAtt

    GAACAAGCACUAAAAGGAAtt

    GCGAAUACUUAUGAACAGAtt

    CCCUGUCAGCAAUGAGUAAtt

    GAGCUUGAUGUUAAACGAAtt

    CUAACCCUGUAACAUCUAAtt

    CCAAUGGUAUUGCUACAUUtt

    GUACCGGUGGUGAACAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATRX(XM_006724667) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ATRX, chromatin remodeler (ATRX), transcript variant X14, mRNA.
  • Synonyms
  • ORF length
    7200
  • siRNA

    CAAUGGUAUUGCUACAUUUtt

    AGAUAAAAGUUGACAGUGAtt

    CAGCGUAUUUGAGAAUUUAtt

    UGAUGAUCAGAAUUCUAUAtt

    CAAUGAUCCUGAGAAUAGAtt

    GAACAAGCACUAAAAGGAAtt

    GCGAAUACUUAUGAACAGAtt

    CCCUGUCAGCAAUGAGUAAtt

    GAGCUUGAUGUUAAACGAAtt

    CUAACCCUGUAACAUCUAAtt

    CCAAUGGUAUUGCUACAUUtt

    GUACCGGUGGUGAACAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATRX(XM_017029602) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ATRX, chromatin remodeler (ATRX), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    7359
  • siRNA

    CAAUGGUAUUGCUACAUUUtt

    AGAUAAAAGUUGACAGUGAtt

    CAGCGUAUUUGAGAAUUUAtt

    UGAUGAUCAGAAUUCUAUAtt

    CAAUGAUCCUGAGAAUAGAtt

    GAACAAGCACUAAAAGGAAtt

    GCGAAUACUUAUGAACAGAtt

    CCCUGUCAGCAAUGAGUAAtt

    GAGCUUGAUGUUAAACGAAtt

    CUAACCCUGUAACAUCUAAtt

    CCAAUGGUAUUGCUACAUUtt

    GUACCGGUGGUGAACAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATRX(XM_005262154) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ATRX, chromatin remodeler (ATRX), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    7392
  • siRNA

    CAAUGGUAUUGCUACAUUUtt

    AGAUAAAAGUUGACAGUGAtt

    CAGCGUAUUUGAGAAUUUAtt

    UGAUGAUCAGAAUUCUAUAtt

    CAAUGAUCCUGAGAAUAGAtt

    GAACAAGCACUAAAAGGAAtt

    GCGAAUACUUAUGAACAGAtt

    CCCUGUCAGCAAUGAGUAAtt

    GAGCUUGAUGUUAAACGAAtt

    CUAACCCUGUAACAUCUAAtt

    CCAAUGGUAUUGCUACAUUtt

    GUACCGGUGGUGAACAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATRX(XM_017029611) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ATRX, chromatin remodeler (ATRX), transcript variant X18, mRNA.
  • Synonyms
  • ORF length
    7113
  • siRNA

    CAAUGGUAUUGCUACAUUUtt

    AGAUAAAAGUUGACAGUGAtt

    CAGCGUAUUUGAGAAUUUAtt

    UGAUGAUCAGAAUUCUAUAtt

    CAAUGAUCCUGAGAAUAGAtt

    GAACAAGCACUAAAAGGAAtt

    GCGAAUACUUAUGAACAGAtt

    CCCUGUCAGCAAUGAGUAAtt

    GAGCUUGAUGUUAAACGAAtt

    CUAACCCUGUAACAUCUAAtt

    CCAAUGGUAUUGCUACAUUtt

    GUACCGGUGGUGAACAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATRX(XM_017029607) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ATRX, chromatin remodeler (ATRX), transcript variant X13, mRNA.
  • Synonyms
  • ORF length
    7245
  • siRNA

    CAAUGGUAUUGCUACAUUUtt

    AGAUAAAAGUUGACAGUGAtt

    CAGCGUAUUUGAGAAUUUAtt

    UGAUGAUCAGAAUUCUAUAtt

    CAAUGAUCCUGAGAAUAGAtt

    GAACAAGCACUAAAAGGAAtt

    GCGAAUACUUAUGAACAGAtt

    CCCUGUCAGCAAUGAGUAAtt

    GAGCUUGAUGUUAAACGAAtt

    CUAACCCUGUAACAUCUAAtt

    CCAAUGGUAUUGCUACAUUtt

    GUACCGGUGGUGAACAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATRX(NM_000489) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens ATRX, chromatin remodeler (ATRX), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    7479
  • Annotation
    This variant (1) encodes the longest isoform (1).
  • siRNA

    CAAUGGUAUUGCUACAUUUtt

    AGAUAAAAGUUGACAGUGAtt

    CAGCGUAUUUGAGAAUUUAtt

    UGAUGAUCAGAAUUCUAUAtt

    CAAUGAUCCUGAGAAUAGAtt

    GAACAAGCACUAAAAGGAAtt

    GCGAAUACUUAUGAACAGAtt

    CCCUGUCAGCAAUGAGUAAtt

    GAGCUUGAUGUUAAACGAAtt

    CUAACCCUGUAACAUCUAAtt

    CCAAUGGUAUUGCUACAUUtt

    GUACCGGUGGUGAACAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATRX(XM_017029605) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ATRX, chromatin remodeler (ATRX), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    7275
  • siRNA

    CAAUGGUAUUGCUACAUUUtt

    AGAUAAAAGUUGACAGUGAtt

    CAGCGUAUUUGAGAAUUUAtt

    UGAUGAUCAGAAUUCUAUAtt

    CAAUGAUCCUGAGAAUAGAtt

    GAACAAGCACUAAAAGGAAtt

    GCGAAUACUUAUGAACAGAtt

    CCCUGUCAGCAAUGAGUAAtt

    GAGCUUGAUGUUAAACGAAtt

    CUAACCCUGUAACAUCUAAtt

    CCAAUGGUAUUGCUACAUUtt

    GUACCGGUGGUGAACAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATRX(XM_017029606) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ATRX, chromatin remodeler (ATRX), transcript variant X12, mRNA.
  • Synonyms
  • ORF length
    7248
  • siRNA

    CAAUGGUAUUGCUACAUUUtt

    AGAUAAAAGUUGACAGUGAtt

    CAGCGUAUUUGAGAAUUUAtt

    UGAUGAUCAGAAUUCUAUAtt

    CAAUGAUCCUGAGAAUAGAtt

    GAACAAGCACUAAAAGGAAtt

    GCGAAUACUUAUGAACAGAtt

    CCCUGUCAGCAAUGAGUAAtt

    GAGCUUGAUGUUAAACGAAtt

    CUAACCCUGUAACAUCUAAtt

    CCAAUGGUAUUGCUACAUUtt

    GUACCGGUGGUGAACAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATRX(XM_006724666) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ATRX, chromatin remodeler (ATRX), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    7362
  • siRNA

    CAAUGGUAUUGCUACAUUUtt

    AGAUAAAAGUUGACAGUGAtt

    CAGCGUAUUUGAGAAUUUAtt

    UGAUGAUCAGAAUUCUAUAtt

    CAAUGAUCCUGAGAAUAGAtt

    GAACAAGCACUAAAAGGAAtt

    GCGAAUACUUAUGAACAGAtt

    CCCUGUCAGCAAUGAGUAAtt

    GAGCUUGAUGUUAAACGAAtt

    CUAACCCUGUAACAUCUAAtt

    CCAAUGGUAUUGCUACAUUtt

    GUACCGGUGGUGAACAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATRX(XM_017029601) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ATRX, chromatin remodeler (ATRX), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    7389
  • siRNA

    CAAUGGUAUUGCUACAUUUtt

    AGAUAAAAGUUGACAGUGAtt

    CAGCGUAUUUGAGAAUUUAtt

    UGAUGAUCAGAAUUCUAUAtt

    CAAUGAUCCUGAGAAUAGAtt

    GAACAAGCACUAAAAGGAAtt

    GCGAAUACUUAUGAACAGAtt

    CCCUGUCAGCAAUGAGUAAtt

    GAGCUUGAUGUUAAACGAAtt

    CUAACCCUGUAACAUCUAAtt

    CCAAUGGUAUUGCUACAUUtt

    GUACCGGUGGUGAACAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATRX(XM_005262156) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ATRX, chromatin remodeler (ATRX), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    7314
  • siRNA

    CAAUGGUAUUGCUACAUUUtt

    AGAUAAAAGUUGACAGUGAtt

    CAGCGUAUUUGAGAAUUUAtt

    UGAUGAUCAGAAUUCUAUAtt

    CAAUGAUCCUGAGAAUAGAtt

    GAACAAGCACUAAAAGGAAtt

    GCGAAUACUUAUGAACAGAtt

    CCCUGUCAGCAAUGAGUAAtt

    GAGCUUGAUGUUAAACGAAtt

    CUAACCCUGUAACAUCUAAtt

    CCAAUGGUAUUGCUACAUUtt

    GUACCGGUGGUGAACAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATRX(XM_017029609) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ATRX, chromatin remodeler (ATRX), transcript variant X16, mRNA.
  • Synonyms
  • ORF length
    7161
  • siRNA

    CAAUGGUAUUGCUACAUUUtt

    AGAUAAAAGUUGACAGUGAtt

    CAGCGUAUUUGAGAAUUUAtt

    UGAUGAUCAGAAUUCUAUAtt

    CAAUGAUCCUGAGAAUAGAtt

    GAACAAGCACUAAAAGGAAtt

    GCGAAUACUUAUGAACAGAtt

    CCCUGUCAGCAAUGAGUAAtt

    GAGCUUGAUGUUAAACGAAtt

    CUAACCCUGUAACAUCUAAtt

    CCAAUGGUAUUGCUACAUUtt

    GUACCGGUGGUGAACAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATRX(XM_006724668) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ATRX, chromatin remodeler (ATRX), transcript variant X20, mRNA.
  • Synonyms
  • ORF length
    5616
  • siRNA

    CAAUGGUAUUGCUACAUUUtt

    AGAUAAAAGUUGACAGUGAtt

    CAGCGUAUUUGAGAAUUUAtt

    UGAUGAUCAGAAUUCUAUAtt

    CAAUGAUCCUGAGAAUAGAtt

    GAACAAGCACUAAAAGGAAtt

    CUAACCCUGUAACAUCUAAtt

    CCAAUGGUAUUGCUACAUUtt

    GUACCGGUGGUGAACAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATRX(XM_005262155) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ATRX, chromatin remodeler (ATRX), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    7362
  • siRNA

    CAAUGGUAUUGCUACAUUUtt

    AGAUAAAAGUUGACAGUGAtt

    CAGCGUAUUUGAGAAUUUAtt

    UGAUGAUCAGAAUUCUAUAtt

    CAAUGAUCCUGAGAAUAGAtt

    GAACAAGCACUAAAAGGAAtt

    GCGAAUACUUAUGAACAGAtt

    CCCUGUCAGCAAUGAGUAAtt

    GAGCUUGAUGUUAAACGAAtt

    CUAACCCUGUAACAUCUAAtt

    CCAAUGGUAUUGCUACAUUtt

    GUACCGGUGGUGAACAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATRX(XM_005262153) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ATRX, chromatin remodeler (ATRX), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    7476
  • siRNA

    CAAUGGUAUUGCUACAUUUtt

    AGAUAAAAGUUGACAGUGAtt

    CAGCGUAUUUGAGAAUUUAtt

    UGAUGAUCAGAAUUCUAUAtt

    CAAUGAUCCUGAGAAUAGAtt

    GAACAAGCACUAAAAGGAAtt

    GCGAAUACUUAUGAACAGAtt

    CCCUGUCAGCAAUGAGUAAtt

    GAGCUUGAUGUUAAACGAAtt

    CUAACCCUGUAACAUCUAAtt

    CCAAUGGUAUUGCUACAUUtt

    GUACCGGUGGUGAACAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATRX(XM_017029610) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ATRX, chromatin remodeler (ATRX), transcript variant X17, mRNA.
  • Synonyms
  • ORF length
    7158
  • siRNA

    CAAUGGUAUUGCUACAUUUtt

    AGAUAAAAGUUGACAGUGAtt

    CAGCGUAUUUGAGAAUUUAtt

    UGAUGAUCAGAAUUCUAUAtt

    CAAUGAUCCUGAGAAUAGAtt

    GAACAAGCACUAAAAGGAAtt

    GCGAAUACUUAUGAACAGAtt

    CCCUGUCAGCAAUGAGUAAtt

    GAGCUUGAUGUUAAACGAAtt

    CUAACCCUGUAACAUCUAAtt

    CCAAUGGUAUUGCUACAUUtt

    GUACCGGUGGUGAACAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATRX(XM_017029603) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ATRX, chromatin remodeler (ATRX), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    7311
  • siRNA

    CAAUGGUAUUGCUACAUUUtt

    AGAUAAAAGUUGACAGUGAtt

    CAGCGUAUUUGAGAAUUUAtt

    UGAUGAUCAGAAUUCUAUAtt

    CAAUGAUCCUGAGAAUAGAtt

    GAACAAGCACUAAAAGGAAtt

    GCGAAUACUUAUGAACAGAtt

    CCCUGUCAGCAAUGAGUAAtt

    GAGCUUGAUGUUAAACGAAtt

    CUAACCCUGUAACAUCUAAtt

    CCAAUGGUAUUGCUACAUUtt

    GUACCGGUGGUGAACAUAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"