NovoPro
Cart 2
  • ANKRD17 Human  cDNA/ORF Clone

ANKRD17 Human cDNA/ORF Clone

Cat.#: 767020-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 985.0 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    ankyrin repeat domain 17
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    ANKRD17
  • Gene Type
    protein coding
  • Also Known as
    GTAR; MASK2; NY-BR-16
  • Product Name
    ANKRD17(XM_005265671) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin repeat domain 17 (ANKRD17), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    7056
  • siRNA

    CUCAUAUUGAUGUACGUAAtt

    CCAGCUACCUUCGACCUUAtt

    GGAGCGAAUGUGAAUAGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANKRD17(NM_198889) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens ankyrin repeat domain 17 (ANKRD17), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    7059
  • Annotation
    This variant (2) lacks an alternate in-frame exon in the central coding region compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter than isoform a.
  • siRNA

    CUCAUAUUGAUGUACGUAAtt

    CCAGCUACCUUCGACCUUAtt

    GGAGCGAAUGUGAAUAGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANKRD17(XM_017008012) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin repeat domain 17 (ANKRD17), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    6720
  • siRNA

    CUCAUAUUGAUGUACGUAAtt

    CCAGCUACCUUCGACCUUAtt

    GGAGCGAAUGUGAAUAGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANKRD17(NM_015574) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens ankyrin repeat domain 17 (ANKRD17), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    7809
  • Annotation
    This variant (4) uses an alternate in-frame splice site in the central coding region codon compared to variant a. The encoded isoform (d) is one amino acid shorter than isoform a.
  • siRNA

    CUCAUAUUGAUGUACGUAAtt

    CCAGCUACCUUCGACCUUAtt

    GGAGCGAAUGUGAAUAGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANKRD17(XM_017008013) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin repeat domain 17 (ANKRD17), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    6717
  • siRNA

    CUCAUAUUGAUGUACGUAAtt

    CCAGCUACCUUCGACCUUAtt

    GGAGCGAAUGUGAAUAGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANKRD17(XM_017008011) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ankyrin repeat domain 17 (ANKRD17), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    7470
  • siRNA

    CUCAUAUUGAUGUACGUAAtt

    CCAGCUACCUUCGACCUUAtt

    GGAGCGAAUGUGAAUAGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANKRD17(NM_032217) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens ankyrin repeat domain 17 (ANKRD17), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    7812
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest isoform (a).
  • siRNA

    CUCAUAUUGAUGUACGUAAtt

    CCAGCUACCUUCGACCUUAtt

    GGAGCGAAUGUGAAUAGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ANKRD17(NM_001286771) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens ankyrin repeat domain 17 (ANKRD17), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    7473
  • Annotation
    This variant (3) differs in its 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant a. The encoded isoform (c) has a distinct N-terminus and is shorter than isoform a.
  • siRNA

    CUCAUAUUGAUGUACGUAAtt

    CCAGCUACCUUCGACCUUAtt

    GGAGCGAAUGUGAAUAGAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"