NovoPro
Cart 2
  • ACACA Human  cDNA/ORF Clone

ACACA Human cDNA/ORF Clone

Cat.#: 755394-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    acetyl-CoA carboxylase alpha
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    ACACA
  • Gene Type
    protein coding
  • Also Known as
    ACC; ACAC; ACC1; ACCA; ACACAD
  • Product Name
    ACACA(NM_198834) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens acetyl-CoA carboxylase alpha (ACACA), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    7152
  • Annotation
    This variant (1) encodes the longest isoform (1).
  • siRNA

    GUUUCGAAAUGAACGUGCAtt

    CCGGAAAUCUGAACGGGAAtt

    GGCUGUAUCCAUUACGUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ACACA(NM_198838) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens acetyl-CoA carboxylase alpha (ACACA), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    6807
  • Annotation
    This variant (5) has a shorter and alternate 5' sequence and uses a downstream start codon, as compared to variant 1. The resulting isoform (4) has a shorter N-terminus, as compared to isoform 1.
  • siRNA

    GUUUCGAAAUGAACGUGCAtt

    CCGGAAAUCUGAACGGGAAtt

    GGCUGUAUCCAUUACGUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ACACA(XM_017024554) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens acetyl-CoA carboxylase alpha (ACACA), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    7152
  • siRNA

    GUUUCGAAAUGAACGUGCAtt

    CCGGAAAUCUGAACGGGAAtt

    GGCUGUAUCCAUUACGUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ACACA(XM_011524701) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens acetyl-CoA carboxylase alpha (ACACA), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    7062
  • siRNA

    GUUUCGAAAUGAACGUGCAtt

    CCGGAAAUCUGAACGGGAAtt

    GGCUGUAUCCAUUACGUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ACACA(XM_006721853) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens acetyl-CoA carboxylase alpha (ACACA), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    7128
  • siRNA

    GUUUCGAAAUGAACGUGCAtt

    CCGGAAAUCUGAACGGGAAtt

    GGCUGUAUCCAUUACGUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ACACA(NM_198839) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens acetyl-CoA carboxylase alpha (ACACA), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    7041
  • Annotation
    This variant (3) has an alternate 5' UTR exon, and uses a downstream start codon, as compared to variant (1). The resulting isoform (2) has a shorter N-terminus, as compared to isoform 1.
  • siRNA

    GUUUCGAAAUGAACGUGCAtt

    CCGGAAAUCUGAACGGGAAtt

    GGCUGUAUCCAUUACGUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ACACA(XM_017024553) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens acetyl-CoA carboxylase alpha (ACACA), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    7176
  • siRNA

    GUUUCGAAAUGAACGUGCAtt

    CCGGAAAUCUGAACGGGAAtt

    GGCUGUAUCCAUUACGUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ACACA(NM_198837) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens acetyl-CoA carboxylase alpha (ACACA), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    6867
  • Annotation
    This variant (4) has a shorter and alternate 5' sequence, as compared to variant 1. The resulting isoform (3) has a distinct and shorter N-terminus, as compared to isoform 1.
  • siRNA

    GUUUCGAAAUGAACGUGCAtt

    CCGGAAAUCUGAACGGGAAtt

    GGCUGUAUCCAUUACGUCAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"