Cart 2
  • HIC1 Human  cDNA/ORF Clone

HIC1 Human cDNA/ORF Clone

Cat.#: 748846-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 367.7 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    HIC ZBTB transcriptional repressor 1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    HIC1
  • Gene Type
    protein coding
  • Also Known as
    hic-1; ZBTB29; ZNF901
  • Encoded Protein Alias
    zinc finger and BTB domain-containing protein 29
  • Product Name
    HIC1(NM_006497) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens HIC ZBTB transcriptional repressor 1 (HIC1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2145
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • siRNA

    UCGUGGCGCUGUGCAAGAAtt

    GCUUCGGUGACAACCUGUAtt

    GCACAGCAACGCAACCUCAtt

    AGUUCGCACAGCAACGCAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    HIC1(NM_001098202) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens HIC ZBTB transcriptional repressor 1 (HIC1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2202
  • Annotation
    This variant (2) contains an alternate in-frame exon in the 5' coding region and uses a downstream start codon, compared to variant 1. Isoform 2 has a shorter N-terminus, compared to isoform 1.
  • siRNA

    UCGUGGCGCUGUGCAAGAAtt

    GCUUCGGUGACAACCUGUAtt

    GCACAGCAACGCAACCUCAtt

    AGUUCGCACAGCAACGCAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"