NovoPro
Cart 2
  • HGSNAT Human  cDNA/ORF Clone

HGSNAT Human cDNA/ORF Clone

Cat.#: 740876-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 313.1 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    heparan-alpha-glucosaminide N-acetyltransferase
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    HGSNAT
  • Gene Type
    protein coding
  • Also Known as
    RP73; HGNAT; MPS3C; TMEM76
  • Encoded Protein Alias
    transmembrane protein 76
  • Product Name
    HGSNAT(XM_005273411) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens heparan-alpha-glucosaminide N-acetyltransferase (HGSNAT), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1827
  • siRNA

    GGACCAACUUGACCGUCUAtt

    GUUUGUAGGUUGGAAUACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    HGSNAT(XM_005273410) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens heparan-alpha-glucosaminide N-acetyltransferase (HGSNAT), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1995
  • siRNA

    GGACCAACUUGACCGUCUAtt

    GUUUGUAGGUUGGAAUACAtt

    CGAUGACUUCUAUACUGCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    HGSNAT(XM_017013089) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens heparan-alpha-glucosaminide N-acetyltransferase (HGSNAT), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    1044
  • siRNA

    GGACCAACUUGACCGUCUAtt

    GUUUGUAGGUUGGAAUACAtt

    CGAUGACUUCUAUACUGCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    HGSNAT(XM_017013088) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens heparan-alpha-glucosaminide N-acetyltransferase (HGSNAT), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1716
  • siRNA

    GGACCAACUUGACCGUCUAtt

    GUUUGUAGGUUGGAAUACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    HGSNAT(XM_005273412) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens heparan-alpha-glucosaminide N-acetyltransferase (HGSNAT), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    1509
  • siRNA

    GGACCAACUUGACCGUCUAtt

    GUUUGUAGGUUGGAAUACAtt

    CGAUGACUUCUAUACUGCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    HGSNAT(XM_005273409) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens heparan-alpha-glucosaminide N-acetyltransferase (HGSNAT), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2019
  • siRNA

    GGACCAACUUGACCGUCUAtt

    GUUUGUAGGUUGGAAUACAtt

    CGAUGACUUCUAUACUGCAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"