NovoPro
Cart 2
  • HNRNPH2 Human  cDNA/ORF Clone

HNRNPH2 Human cDNA/ORF Clone

Cat.#: 713916-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 140.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    heterogeneous nuclear ribonucleoprotein H2 (H')
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    HNRNPH2
  • Gene Type
    protein coding
  • Also Known as
    FTP3; MRXSB; HNRPH'; HNRPH2; hnRNPH'
  • Encoded Protein Alias
    heterogeneous nuclear ribonucleoprotein H2; FTP-3; heterogeneous nuclear ribonucleoprotein H-prime; hnRNP H'; hnRNP H2
  • Vector Name
    pCR4-TOPO
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3956
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    None
  • Description
    TOPO Cloning vector with ampicillin resistance in bacteria.
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"