• GRAMD1A Human  cDNA/ORF Clone

GRAMD1A Human cDNA/ORF Clone

Cat.#: 746562-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 378.5 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    GRAM domain containing 1A
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    GRAMD1A
  • Gene Type
    protein coding
  • Also Known as
    KIAA1533
  • Encoded Protein Alias
    GRAM domain-containing protein 1A
  • Product Name
    GRAMD1A(XM_011527154) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens GRAM domain containing 1A (GRAMD1A), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    2208
  • siRNA

    GGAGCGGCAUUGAAGACUAtt

    GAAGUGACAUGUCUGAAGAtt

    GAGGAGCUAUUGACAGACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    GRAMD1A(XM_011527153) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens GRAM domain containing 1A (GRAMD1A), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    2436
  • siRNA

    GGAGCGGCAUUGAAGACUAtt

    GAAGUGACAUGUCUGAAGAtt

    GAGGAGCUAUUGACAGACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    GRAMD1A(NM_020895) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens GRAM domain containing 1A (GRAMD1A), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2175
  • Annotation
    This variant (1) encodes isoform 1.
  • siRNA

    GGAGCGGCAUUGAAGACUAtt

    GAAGUGACAUGUCUGAAGAtt

    GAGGAGCUAUUGACAGACAtt

  • DataSheet:
  • DataSheet:
  • FAQs:
  • Product Name
    GRAMD1A(XM_011527156) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens GRAM domain containing 1A (GRAMD1A), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    1473
  • siRNA

    GGAGCGGCAUUGAAGACUAtt

    GAAGUGACAUGUCUGAAGAtt

    GAGGAGCUAUUGACAGACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    GRAMD1A(NM_001320035) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens GRAM domain containing 1A (GRAMD1A), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    1461
  • Annotation
    This variant (4) lacks an alternate internal exon compared to variant 1. This variant represents translation initiation at an alternate start codon compared to variant 1; the 5'-most initiation codon, as used in variant 1, is associated with a truncated ORF that would render the transcript a candidate for nonsense-mediated decay (NMD). Leaky scanning may allow translation initiation at the alternate start codon to encode an isoform (4) that has a shorter and distinct N-terminus, compared to isoform 1.
  • siRNA

    GGAGCGGCAUUGAAGACUAtt

    GAAGUGACAUGUCUGAAGAtt

    GAGGAGCUAUUGACAGACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    GRAMD1A(NM_001320034) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens GRAM domain containing 1A (GRAMD1A), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    2163
  • Annotation
    This variant (3) lacks an alternate in-frame exon, compared to variant 1. The encoded isoform (3) has the same N- and C-termini, but is four amino acids shorter than isoform 1.
  • siRNA

    GGAGCGGCAUUGAAGACUAtt

    GAAGUGACAUGUCUGAAGAtt

    GAGGAGCUAUUGACAGACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    GRAMD1A(XM_011527155) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens GRAM domain containing 1A (GRAMD1A), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    2190
  • siRNA

    GGAGCGGCAUUGAAGACUAtt

    GAAGUGACAUGUCUGAAGAtt

    GAGGAGCUAUUGACAGACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    GRAMD1A(XM_017027034) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens GRAM domain containing 1A (GRAMD1A), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    2127
  • siRNA

    GGAGCGGCAUUGAAGACUAtt

    GAAGUGACAUGUCUGAAGAtt

    GAGGAGCUAUUGACAGACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    GRAMD1A(NM_001136199) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens GRAM domain containing 1A (GRAMD1A), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2142
  • Annotation
    This variant (2) lacks two alternate in-frame exons, compared to variant 1. The encoded isoform (2) has the same N- and C-termini, but is 11 amino acids shorter than isoform 1.
  • siRNA

    GGAGCGGCAUUGAAGACUAtt

    GAAGUGACAUGUCUGAAGAtt

    GAGGAGCUAUUGACAGACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    GRAMD1A(NM_001320036) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens GRAM domain containing 1A (GRAMD1A), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    2421
  • Annotation
    This variant (5) contains two alternate exons in the 5' UTR, lacks a portion of the 5' coding region, initiates translation at an alternate start codon, and uses an alternate in-frame splice site in the central coding region compared to variant 1. The encoded isoform (5) has a longer and distinct N-terminus and lacks an internal amino acid, compared to isoform 1.
  • siRNA

    GGAGCGGCAUUGAAGACUAtt

    GAAGUGACAUGUCUGAAGAtt

    GAGGAGCUAUUGACAGACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    GRAMD1A(XM_011527149) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens GRAM domain containing 1A (GRAMD1A), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2172
  • siRNA

    GGAGCGGCAUUGAAGACUAtt

    GAAGUGACAUGUCUGAAGAtt

    GAGGAGCUAUUGACAGACAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pOTB7
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    1815
  • Vector Type
    Cloning Vector
  • Promoter
    -
  • Antibiotic Resistance
    Chloramphenicol
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Gateway® or compatible clone with M13 forward and M13 reverse primers. Chloramphenicol resistance in bacteria.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"