NovoPro
Cart 2
  • Gfi1 Mouse  cDNA/ORF Clone

Gfi1 Mouse cDNA/ORF Clone

Cat.#: 749437-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 252.0 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    growth factor independent 1
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Gfi1
  • Gene Type
    protein coding
  • Also Known as
    Pal1; Gfi-1; Pal-1; AW495828
  • Encoded Protein Alias
    growth factor independent protein 1
  • Product Name
    Gfi1(NM_001267621) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus growth factor independent 1 (Gfi1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1470
  • Annotation
    This variant (2) includes an alternate 5' exon and thus differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (2) has a distinct and longer N-terminus, compared to isoform 1.
  • siRNA

    GAACGCAGCUUUGACUGUAtt

    CCUCAUCACUCAUAGCAGAtt

    GAAGUCAGAUAUGAAGAAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"