NovoPro
Cart 2
  • Gabrr1 Mouse  cDNA/ORF Clone

Gabrr1 Mouse cDNA/ORF Clone

Cat.#: 749452-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 238.1 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    gamma-aminobutyric acid (GABA) C receptor, subunit rho 1
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Gabrr1
  • Gene Type
    protein coding
  • Also Known as
    GABA-C
  • Encoded Protein Alias
    GABA(A) receptor subunit rho-1; GABA(C) receptor; gamma-aminobutyric acid (GABA-A) receptor, subunit rho 1; gamma-aminobutyric acid (GABA-C) receptor, subunit rho 1
  • Product Name
    Gabrr1(NM_008075) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus gamma-aminobutyric acid (GABA) C receptor, subunit rho 1 (Gabrr1), mRNA.
  • Synonyms
  • ORF length
    1443
  • siRNA

    GAAGCUCUGACAUAACCAAtt

    CCACAAAACUAGCCUUCUAtt

    GCAUGAGGAUCAACACUCAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"