Cart 2
  • Foxo1 Rat  cDNA/ORF Clone

Foxo1 Rat cDNA/ORF Clone

Cat.#: 704142-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 334.2 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    forkhead box O1
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Foxo1
  • Gene Type
    protein coding
  • Also Known as
    Fkhr; Foxo1a
  • Encoded Protein Alias
    forkhead box protein O1; Forkhead box protein O1A; Forkhead in rhabdomyosarcoma; forkhead box O1A (rhabdomyosarcoma)
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"