NovoPro
Cart 2
  • FKBP4 Human  cDNA/ORF Clone

FKBP4 Human cDNA/ORF Clone

Cat.#: 713959-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 229.7 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    FK506 binding protein 4
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    FKBP4
  • Gene Type
    protein coding
  • Also Known as
    HBI; p52; Hsp56; FKBP51; FKBP52; FKBP59; PPIase
  • Encoded Protein Alias
    peptidyl-prolyl cis-trans isomerase FKBP4; 51 kDa FK506-binding protein; FK506-binding protein 4 (59kD); HSP binding immunophilin; T-cell FK506-binding protein, 59kD; peptidylprolyl cis-trans isomerase; rotamase
  • Product Name
    FKBP4(XM_011520929) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens FK506 binding protein 4 (FKBP4), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1245
  • siRNA

    GCUUUACUACAGUAUAAGAtt

    CCCUAGAACUGGACAGCAAtt

    CAUUCCAUCGUGUACCUCAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pOTB7
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    1815
  • Vector Type
    Cloning Vector
  • Promoter
    -
  • Antibiotic Resistance
    Chloramphenicol
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Gateway® or compatible clone with M13 forward and M13 reverse primers. Chloramphenicol resistance in bacteria.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"