NovoPro
Cart 2
  • FABP7 Human  cDNA/ORF Clone

FABP7 Human cDNA/ORF Clone

Cat.#: 713948-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    fatty acid binding protein 7
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    FABP7
  • Gene Type
    protein coding
  • Also Known as
    MRG; BLBP; FABPB; B-FABP
  • Encoded Protein Alias
    fatty acid-binding protein, brain; Hypothetical protein DKFZp547J2313; brain lipid binding protein; brain lipid-binding protein; brain-type fatty acid-binding protein; fatty acid-binding protein 7; mammary-derived growth inhibitor related; mammary-derived growth inhibitor-related
  • Product Name
    FABP7(NM_001319042) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens fatty acid binding protein 7 (FABP7), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    387
  • Annotation
    This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon compared to variant 1. The encoded isoform (4) has a distinct N-terminus and is shorter than isoform 1. The 5' end of this transcript contains long terminal repeat (LTR) sequence and initiates from an LTR promoter. (PMID: 25114248).
  • siRNA

    ACUUGUUCACAUACAGAAAtt

    CGGUAAUUAUCAGUCAAGAtt

    AGAACACGGAGAUUAGUUUtt

    CAACGGUAAUUAUCAGUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    FABP7(NM_001319041) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens fatty acid binding protein 7 (FABP7), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    294
  • Annotation
    This variant (3) retains two alternate segments compared to variant 1, resulting in a distinct 3' coding region and 3' UTR. The encoded isoform (3) has a distinct C-terminus and is shorter than isoform 1.
  • siRNA

    ACUUGUUCACAUACAGAAAtt

    CGGUAAUUAUCAGUCAAGAtt

    AGAACACGGAGAUUAGUUUtt

    CAACGGUAAUUAUCAGUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    FABP7(NM_001319039) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens fatty acid binding protein 7 (FABP7), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    501
  • Annotation
    This variant (2) differs in the 3' coding region and 3' UTR compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is longer than isoform 1.
  • siRNA

    ACUUGUUCACAUACAGAAAtt

    CGGUAAUUAUCAGUCAAGAtt

    AGAACACGGAGAUUAGUUUtt

    CAACGGUAAUUAUCAGUCAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"