NovoPro
Cart 2
  • FAM26D Human  cDNA/ORF Clone

FAM26D Human cDNA/ORF Clone

Cat.#: 702196-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    family with sequence similarity 26 member D
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    FAM26D
  • Gene Type
    protein coding
  • Also Known as
    C6orf78
  • Encoded Protein Alias
    protein FAM26D
  • Product Name
    FAM26D(XM_017010391) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens family with sequence similarity 26 member D (FAM26D), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    603
  • siRNA

    AGAUAUUUCAGUACCCACUtt

    GACUUGCAAGGUCACUAUAtt

    GCAUCGCAUAAAGAAGCUAtt

    CCUCAUGAUGCAUCGCAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    FAM26D(NM_001256888) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens family with sequence similarity 26 member D (FAM26D), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    513
  • Annotation
    This variant (2) differs in the 5' UTR and 5' coding region, and uses an alternate start codon, compared to variant 1. The encoded isoform (b) has a distinct and shorter N-terminus, compared to isoform a.
  • siRNA

    AGAUAUUUCAGUACCCACUtt

    GACUUGCAAGGUCACUAUAtt

    GCAUCGCAUAAAGAAGCUAtt

    CCUCAUGAUGCAUCGCAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    FAM26D(XM_017010390) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens family with sequence similarity 26 member D (FAM26D), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    648
  • siRNA

    AGAUAUUUCAGUACCCACUtt

    GACUUGCAAGGUCACUAUAtt

    GCAUCGCAUAAAGAAGCUAtt

    CCUCAUGAUGCAUCGCAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    FAM26D(NM_153036) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens family with sequence similarity 26 member D (FAM26D), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    387
  • Annotation
    This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (c) is shorter at the N-terminus, compared to isoform a. Both variants 3 and 4 encode isoform c.
  • siRNA

    AGAUAUUUCAGUACCCACUtt

    GACUUGCAAGGUCACUAUAtt

    GCAUCGCAUAAAGAAGCUAtt

    CCUCAUGAUGCAUCGCAUAtt

  • DataSheet:
  • FAQs:
  • DataSheet:
  • FAQs:
  • Product Name
    FAM26D(NM_001256887) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens family with sequence similarity 26 member D (FAM26D), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    516
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest isoform (a).
  • siRNA

    AGAUAUUUCAGUACCCACUtt

    GACUUGCAAGGUCACUAUAtt

    GCAUCGCAUAAAGAAGCUAtt

    CCUCAUGAUGCAUCGCAUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"