NovoPro
Cart 2
  • EXOSC10 Human  cDNA/ORF Clone

EXOSC10 Human cDNA/ORF Clone

Cat.#: 712665-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 236.0 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    exosome component 10
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    EXOSC10
  • Gene Type
    protein coding
  • Also Known as
    p2; p3; p4; RRP6; PMSCL; Rrp6p; PM-Scl; PMSCL2; PM/Scl-100
  • Encoded Protein Alias
    exosome component 10; P100 polymyositis-scleroderma overlap syndrome-associated autoantigen; autoantigen PM-SCL; polymyositis/scleroderma autoantigen 100 kDa; polymyositis/scleroderma autoantigen 2
  • Product Name
    EXOSC10(XM_017001496) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens exosome component 10 (EXOSC10), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1377
  • siRNA

    GAGUAUGAUUUUUACCGAAtt

    GGAUCGAAGUAAAGUGACUtt

    GGAUGAGUCCUACCUUGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    EXOSC10(XM_017001497) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens exosome component 10 (EXOSC10), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    1362
  • siRNA

    GAGUAUGAUUUUUACCGAAtt

    GGAUCGAAGUAAAGUGACUtt

    GGAUGAGUCCUACCUUGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    EXOSC10(XM_005263475) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens exosome component 10 (EXOSC10), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2673
  • siRNA

    GAGUAUGAUUUUUACCGAAtt

    GGAUCGAAGUAAAGUGACUtt

    GGAUGAGUCCUACCUUGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    EXOSC10(XM_017001494) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens exosome component 10 (EXOSC10), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1425
  • siRNA

    GAGUAUGAUUUUUACCGAAtt

    GGAUCGAAGUAAAGUGACUtt

    GGAUGAGUCCUACCUUGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    EXOSC10(NM_002685) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens exosome component 10 (EXOSC10), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2583
  • Annotation
    This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
  • siRNA

    GAGUAUGAUUUUUACCGAAtt

    GGAUCGAAGUAAAGUGACUtt

    GGAUGAGUCCUACCUUGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    EXOSC10(XM_017001495) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens exosome component 10 (EXOSC10), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1410
  • siRNA

    GAGUAUGAUUUUUACCGAAtt

    GGAUCGAAGUAAAGUGACUtt

    GGAUGAGUCCUACCUUGAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"