Cart 2
  • ETV2 Human  cDNA/ORF Clone

ETV2 Human cDNA/ORF Clone

Cat.#: 748906-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 249.9 USD

Availability: 1 week
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    ETS variant 2
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    ETV2
  • Gene Type
    protein coding
  • Also Known as
    ER71; ETSRP71
  • Encoded Protein Alias
    ets variant gene 2; ets-related protein 71
  • Product Name
    ETV2(NM_014209) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens ETS variant 2 (ETV2), transcript variant 1, mRNA.
  • Synonyms
    XM_290831  
  • ORF length
    1029
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • siRNA

    CUGUUUCCCUGAUCUGGCAtt

    CGCACGGACUGUACCAUUUtt

    UCUUUGAAGCGGUACCAGAtt

    GCGCACGGACUGUACCAUUtt

    CGGGCAUGAAUUACGAGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ETV2(NM_001300974) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens ETS variant 2 (ETV2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    750
  • Annotation
    This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream start codon, compared to variant 1. It encodes isoform 2, which has a shorter N-terminus, compared to isoform 1.
  • siRNA

    CUGUUUCCCUGAUCUGGCAtt

    CGCACGGACUGUACCAUUUtt

    UCUUUGAAGCGGUACCAGAtt

    GCGCACGGACUGUACCAUUtt

    CGGGCAUGAAUUACGAGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ETV2(NM_001304549) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens ETS variant 2 (ETV2), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    468
  • Annotation
    This variant (3) lacks two in-frame exons compared to variant 1. It encodes isoform 3, which is shorter than isoform 1.
  • siRNA

    CUGUUUCCCUGAUCUGGCAtt

    CGGGCAUGAAUUACGAGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ETV2(XM_005258652) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ETS variant 2 (ETV2), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1113
  • siRNA

    CUGUUUCCCUGAUCUGGCAtt

    CGCACGGACUGUACCAUUUtt

    UCUUUGAAGCGGUACCAGAtt

    GCGCACGGACUGUACCAUUtt

    CGGGCAUGAAUUACGAGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ETV2(XM_017026472) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ETS variant 2 (ETV2), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1032
  • siRNA

    CUGUUUCCCUGAUCUGGCAtt

    CGCACGGACUGUACCAUUUtt

    UCUUUGAAGCGGUACCAGAtt

    GCGCACGGACUGUACCAUUtt

    CGGGCAUGAAUUACGAGAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEnCMV
  • primers
    CMV fwd: cg caaatgggcg gtaggcgtg
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5936
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    None
  • Description
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"