Cart 2
  • ELAVL2 Human  cDNA/ORF Clone

ELAVL2 Human cDNA/ORF Clone

Cat.#: 719276-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 185.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    ELAV like RNA binding protein 2
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    ELAVL2
  • Gene Type
    protein coding
  • Also Known as
    HUB; HELN1; HEL-N1
  • Encoded Protein Alias
    ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B); ELAV-like neuronal protein 1 isoform Hel-N2; hu-antigen B; nervous system-specific RNA-binding protein Hel-N1
  • Product Name
    ELAVL2(NM_001171195) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens ELAV like RNA binding protein 2 (ELAVL2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1041
  • Annotation
    This variant (2) differs in the 5' UTR and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Variants 2 and 3 both encode the same isoform.
  • siRNA

    CCAACUUAAUAGUCAACUAtt

    CAAUGACCAUUGACGGAAUtt

    CACCCUGAAUGGAUUGAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ELAVL2(XM_017014417) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ELAV like neuron-specific RNA binding protein 2 (ELAVL2), transcript variant X19, mRNA.
  • Synonyms
  • ORF length
    1122
  • siRNA

    CCAACUUAAUAGUCAACUAtt

    CAAUGACCAUUGACGGAAUtt

    CACCCUGAAUGGAUUGAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ELAVL2(XM_017014415) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ELAV like neuron-specific RNA binding protein 2 (ELAVL2), transcript variant X15, mRNA.
  • Synonyms
  • ORF length
    1131
  • siRNA

    CCAACUUAAUAGUCAACUAtt

    CAAUGACCAUUGACGGAAUtt

    CACCCUGAAUGGAUUGAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ELAVL2(XM_011517783) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ELAV like neuron-specific RNA binding protein 2 (ELAVL2), transcript variant X18, mRNA.
  • Synonyms
  • ORF length
    1125
  • siRNA

    CCAACUUAAUAGUCAACUAtt

    CAAUGACCAUUGACGGAAUtt

    CACCCUGAAUGGAUUGAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ELAVL2(XM_011517778) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ELAV like neuron-specific RNA binding protein 2 (ELAVL2), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1179
  • siRNA

    CCAACUUAAUAGUCAACUAtt

    CAAUGACCAUUGACGGAAUtt

    CACCCUGAAUGGAUUGAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    ELAVL2(XM_017014426) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ELAV like neuron-specific RNA binding protein 2 (ELAVL2), transcript variant X37, mRNA.
  • Synonyms
  • ORF length
    678
  • siRNA

    CAAUGACCAUUGACGGAAUtt

    CACCCUGAAUGGAUUGAGAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"