Cart 2
  • Elavl2 Mouse  cDNA/ORF Clone

Elavl2 Mouse cDNA/ORF Clone

Cat.#: 709324-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 267.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Elavl2
  • Gene Type
    protein coding
  • Also Known as
    Hub; mel-N1
  • Encoded Protein Alias
    ELAV-like protein 2; ELAV-like neuronal protein 1; HU-antigen B; nervous system-specific RNA-binding protein Mel-N1
  • Product Name
    Elavl2(NM_207685) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) (Elavl2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1122
  • Annotation
    This variant (1) differs in the 5' UTR and coding sequence compared to variant 5. The resulting isoform (1) has a shorter and distinct N-terminus compared to isoform 5.
  • siRNA

    CAUCAUUACUUCUCGGAUUtt

    CCAACCUAAUAGUCAACUAtt

    GAUGCAAACUUAUACGUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Elavl2(NM_001177883) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) (Elavl2), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    1080
  • Annotation
    This variant (4) lacks an alterntae exon in the 5' end, which causes translation initiation at a downstream start codon, compared to variant 5. The resulting isoform (4) has a shorter N-terminus when it is compared to isoform 5.
  • siRNA

    CAUCAUUACUUCUCGGAUUtt

    CCAACCUAAUAGUCAACUAtt

    GAUGCAAACUUAUACGUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Elavl2(NM_207686) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) (Elavl2), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1044
  • Annotation
    This variant (3) has multiple differences, one of which causes translation initiation at a downstream start codon, compared to variant 5. The resulting isoform (3) has a shorter N-terminus and has one additional aa in the C-terminus when it is compared to isoform 5.
  • siRNA

    CAUCAUUACUUCUCGGAUUtt

    CCAACCUAAUAGUCAACUAtt

    GAUGCAAACUUAUACGUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Elavl2(NM_010486) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) (Elavl2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1083
  • Annotation
    This variant (2) has multiple differences, one of which causes translation initiation at a downstream start codon, compared to variant 5. The resulting isoform (2) has a shorter N-terminus and has one additional aa in the C-terminus when it is compared to isoform 5.
  • siRNA

    CAUCAUUACUUCUCGGAUUtt

    CCAACCUAAUAGUCAACUAtt

    GAUGCAAACUUAUACGUCAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"