NovoPro
Cart 2
  • EDIL3 Human  cDNA/ORF Clone

EDIL3 Human cDNA/ORF Clone

Cat.#: 710518-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 140.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    EGF like repeats and discoidin domains 3
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    EDIL3
  • Gene Type
    protein coding
  • Also Known as
    DEL1
  • Encoded Protein Alias
    EGF-like repeat and discoidin I-like domain-containing protein 3; developmental endothelial locus-1; developmentally-regulated endothelial cell locus 1 protein; integrin-binding protein DEL1
  • Product Name
    EDIL3(NM_001278642) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens EGF like repeats and discoidin domains 3 (EDIL3), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1413
  • Annotation
    This variant (2) lacks an in-frame exon in the coding region, compared to variant 1. The resulting isoform (2) lacks an internal segment, compared to isoform 1.
  • siRNA

    CAGAUCUUGUUGCUAACUAtt

    GGGAUUCACUGUCAGCACAtt

    GUACAGAUCUUGUUGCUAAtt

    CAAAAAUGGUGGAAUAUGUtt

    CGUGGACAGCUGCAGAAAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"