NovoPro
Cart 2
  • CDKN2A Human  cDNA/ORF Clone

CDKN2A Human cDNA/ORF Clone

Cat.#: 714567-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    cyclin dependent kinase inhibitor 2A
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CDKN2A
  • Gene Type
    protein coding
  • Also Known as
    ARF; MLM; P14; P16; P19; CMM2; INK4; MTS1; TP16; CDK4I; CDKN2; INK4A; MTS-1; P14ARF; P19ARF; P16INK4; P16INK4A; P16-INK4A
  • Encoded Protein Alias
    cyclin-dependent kinase inhibitor 2A; CDK4 inhibitor p16-INK4; CDKN2A; alternative reading frame; cell cycle negative regulator beta; cyclin-dependent kinase 4 inhibitor A; cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4); multiple tumor suppressor 1
  • Product Name
    CDKN2A(XM_005251343) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens cyclin-dependent kinase inhibitor 2A (CDKN2A), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    318
  • siRNA

    CUACCGUAAAUGUCCAUUUtt

    CCGUAAAUGUCCAUUUAUAtt

    UGUCCUGCCUUUUAACGUAtt

    CGCUUUCGUAGUUUUCAUUtt

    UACCGUAAAUGUCCAUUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CDKN2A(NM_000077) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cyclin dependent kinase inhibitor 2A (CDKN2A), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    471
  • Annotation
    This variant (1) is also known as alpha. Transcripts 1 and 4, encoding p16INK4a and p14ARF, have distinct first exons which contain the translation start codon, and share a common second exon, which is translated in different reading frames. Thus, the p16INK4a protein encoded by this variant (1) lacks sequence similarity to the protein product of variant 4 (p14ARF).
  • siRNA

    CUACCGUAAAUGUCCAUUUtt

    CCGUAAAUGUCCAUUUAUAtt

    UGUCCUGCCUUUUAACGUAtt

    CGCUUUCGUAGUUUUCAUUtt

    UACCGUAAAUGUCCAUUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CDKN2A(NM_001195132) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cyclin dependent kinase inhibitor 2A (CDKN2A), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    504
  • Annotation
    This variant (5) includes an additional exon that causes a frameshift in the 3' coding region, compared to variant 1 (encoding p16INK4a). The resulting isoform (p16gamma) has a distinct C-terminus and is longer than p16INK4a. This variant has been described in PMID:17486064. It is a candidate for nonsense-mediated mRNA decay (NMD), but it is not known if the endogenous protein is expressed in vivo.
  • siRNA

    CUACCGUAAAUGUCCAUUUtt

    CCGUAAAUGUCCAUUUAUAtt

    UGUCCUGCCUUUUAACGUAtt

    CGCUUUCGUAGUUUUCAUUtt

    UACCGUAAAUGUCCAUUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CDKN2A(NM_058195) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cyclin dependent kinase inhibitor 2A (CDKN2A), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    399
  • Annotation
    This variant (4), also known as beta, encodes isoform p14ARF. Transcripts 1 and 4, encoding p16INK4a and p14ARF have distinct first exons which contain the translation start codon, and share a common second exon, which is translated in different reading frames. Thus, the p16INK4a protein encoded by this variant (1) lacks sequence similarity to the protein product of variant 4 (p14ARF). Note that this variant may use an alternative upstream start codon, which would produce an isoform that is 41 aa longer at the N-terminus, or an alternative downstream start codon, which would produce an isoform (smARF, described in PMID:16713577) that is 47 aa shorter at the N-terminus; it is unclear if the isoforms derived from the alternative start codons are present in vivo. The p14ARF isoform is known to be nucleoplasmic but may also be recruited to mitochondria, as described in PMID:20107316.
  • siRNA

    CUACCGUAAAUGUCCAUUUtt

    CCGUAAAUGUCCAUUUAUAtt

    UGUCCUGCCUUUUAACGUAtt

    CGCUUUCGUAGUUUUCAUUtt

    UACCGUAAAUGUCCAUUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CDKN2A(NM_058197) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cyclin dependent kinase inhibitor 2A (CDKN2A), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    351
  • Annotation
    This variant (3) contains an alternate open reading frame (ARF), when compared to variants 1 or 4. The ARF results from an alternative splicing between a distinct first exon, which contains the translation start codon, and the common second exon. Thus, the protein encoded by this variant (p12) lacks sequence similarity to the protein product of variant 4. This variant is specifically expressed in pancreas, and has been described in PMID:10445844. It is a candidate for nonsense-mediated mRNA decay (NMD), but it is not known if the endogenous protein is expressed in vivo.
  • siRNA

    CUACCGUAAAUGUCCAUUUtt

    CCGUAAAUGUCCAUUUAUAtt

    UGUCCUGCCUUUUAACGUAtt

    CGCUUUCGUAGUUUUCAUUtt

    UACCGUAAAUGUCCAUUUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"