NovoPro
Cart 2
  • Cxcl3 Rat  cDNA/ORF Clone

Cxcl3 Rat cDNA/ORF Clone

Cat.#: 741827-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    chemokine (C-X-C motif) ligand 3
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Cxcl3
  • Gene Type
    protein coding
  • Also Known as
    Cinc2; Cinc-2; Gm1960
  • Encoded Protein Alias
    MIP2-alpha/beta; cytokine-induced neutrophil chemoattractant 2; cytokine-induced neutrophil chemoattractant-2; macrophage inflammatory protein 2-alpha/beta
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"