Cart 2
  • Crtc3 Mouse  cDNA/ORF Clone

Crtc3 Mouse cDNA/ORF Clone

Cat.#: 743592-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 318.3 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    CREB regulated transcription coactivator 3
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Crtc3
  • Gene Type
    protein coding
  • Also Known as
    TORC3; AI429792; BC011210; 2610312F20Rik; 6332415K15Rik
  • Encoded Protein Alias
    TORC-3; transducer of CREB protein 3; transducer of regulated cAMP response element-binding protein 3
  • Product Name
    Crtc3(NM_173863) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus CREB regulated transcription coactivator 3 (Crtc3), mRNA.
  • Synonyms
  • ORF length
    1860
  • siRNA

    CAUUCCACUUGAGACCAAAtt

    GACCAAUUCUGAUUCUGCUtt

    GGAUGUGCGCUUUGACCAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"