Cart 2
  • CD48 Cattle  cDNA/ORF Clone

CD48 Cattle cDNA/ORF Clone

Cat.#: 773191-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 179.4 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    CD48 molecule
  • Organism
    Cattle
  • Entrez Gene ID
  • Gene Symbol
    CD48
  • Gene Type
    protein coding
  • Encoded Protein Alias
    CD48 molecule
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"