Cart 2
  • ATP6V0E1 Cattle  cDNA/ORF Clone

ATP6V0E1 Cattle cDNA/ORF Clone

Cat.#: 772083-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    ATPase H+ transporting V0 subunit e1
  • Organism
    Cattle
  • Entrez Gene ID
  • Gene Symbol
    ATP6V0E1
  • Gene Type
    protein coding
  • Also Known as
    ATP6V0E
  • Encoded Protein Alias
    ATPase H+ transporting V0 subunit e1
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"