• C8B Human  cDNA/ORF Clone

C8B Human cDNA/ORF Clone

Cat.#: 715294-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 277.7 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    complement C8 beta chain
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    C8B
  • Gene Type
    protein coding
  • Also Known as
    C82
  • Encoded Protein Alias
    complement component 8 subunit beta
  • Product Name
    C8B(NM_001278543) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens complement C8 beta chain (C8B), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1620
  • Annotation
    This variant (2) differs in the 5' UTR and 5' coding region compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (2) with a shorter N-terminus, compared to isoform 1.
  • siRNA

    CUCUCAUACUAAAAGCGUAtt

    GACCCAAGGCAAAUACGAAtt

    GGUCAAAUGCAGUCAACAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C8B(NM_001278544) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens complement C8 beta chain (C8B), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1590
  • Annotation
    This variant (3) differs in the 5' UTR and 5' coding region compared to variant 1. These differences cause translation initiation at an alternate AUG and result in an isoform (3) with a shorter and distinct N-terminus, compared to isoform 1.
  • siRNA

    CUCUCAUACUAAAAGCGUAtt

    GACCCAAGGCAAAUACGAAtt

    GGUCAAAUGCAGUCAACAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C8B(XM_017002235) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens complement component 8, beta polypeptide (C8B), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1776
  • siRNA

    CUCUCAUACUAAAAGCGUAtt

    GACCCAAGGCAAAUACGAAtt

    GGUCAAAUGCAGUCAACAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCR4-TOPO
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3956
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    None
  • Description
    TOPO Cloning vector with ampicillin resistance in bacteria.
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"