NovoPro
Cart 2
  • CHRNA9 Human  cDNA/ORF Clones

CHRNA9 Human cDNA/ORF Clones

Cat.#: 718424-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 214.7 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    cholinergic receptor nicotinic alpha 9 subunit
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CHRNA9
  • Gene Type
    protein coding
  • Also Known as
    NACHRA9; HSA243342
  • Encoded Protein Alias
    NACHR alpha 9; acetylcholine receptor, neuronal nicotinic, alpha-9 subunit; cholinergic receptor, nicotinic alpha 9; cholinergic receptor, nicotinic, alpha 9 (neuronal); cholinergic receptor, nicotinic, alpha polypeptide 9; neuronal acetylcholine receptor protein, alpha-9 subunit; nicotinic acetylcholine receptor subunit alpha 9
  • Vector Name
    pCR4-TOPO
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3956
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    None
  • Description
    TOPO Cloning vector with ampicillin resistance in bacteria.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"