NovoPro
Cart 2
  • Ccl21 Rat  cDNA/ORF Clone

Ccl21 Rat cDNA/ORF Clone

Cat.#: 715255-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 229.7 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    C-C motif chemokine ligand 21
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Ccl21
  • Gene Type
    protein coding
  • Also Known as
    Ccl21b
  • Encoded Protein Alias
    chemokine (C-C motif) ligand 21b (serine); small inducible cytokine A21
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"