Cart 2
  • CEP85L Human  cDNA/ORF Clone

CEP85L Human cDNA/ORF Clone

Cat.#: 735974-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 385.1 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    centrosomal protein 85 like
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CEP85L
  • Gene Type
    protein coding
  • Also Known as
    C6orf204; NY-BR-15; bA57K17.2
  • Encoded Protein Alias
    serologically defined breast cancer antigen NY-BR-15
  • Product Name
    CEP85L(XM_011535810) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens centrosomal protein 85 like (CEP85L), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    2247
  • siRNA

    GCAUAGUUCAGCUUAGGCAtt

    CAAGUCUAAUAACACUAUUtt

    GCUAAGAACAUGGACUAUAtt

    GGUGCUAGGUGGUUACAUUtt

    CAUGCUCACUCAGACUAUAtt

    CUGACUUAGUAGGAAGUUAtt

    CAGUGUUCAUGACUUAAUUtt

    GGCUUAAUUUGAACUAUUAtt

    CAAAUAAGAUGGGCAAAUAtt

    CUAAGGAGCUUAUAAAGUAtt

    CAUCUAACCAUCGAAAUAAtt

    CCUGUAGACAUGACAUAUAtt

    CUGAUAGCGUGGAAGAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CEP85L(XM_006715475) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens centrosomal protein 85 like (CEP85L), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    2112
  • siRNA

    GCAUAGUUCAGCUUAGGCAtt

    CAAGUCUAAUAACACUAUUtt

    GCUAAGAACAUGGACUAUAtt

    GGUGCUAGGUGGUUACAUUtt

    CAUGCUCACUCAGACUAUAtt

    CUGACUUAGUAGGAAGUUAtt

    CAGUGUUCAUGACUUAAUUtt

    GGCUUAAUUUGAACUAUUAtt

    CAAAUAAGAUGGGCAAAUAtt

    CUAAGGAGCUUAUAAAGUAtt

    CAUCUAACCAUCGAAAUAAtt

    CCUGUAGACAUGACAUAUAtt

    CUGAUAGCGUGGAAGAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CEP85L(XM_017010847) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens centrosomal protein 85 like (CEP85L), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    2238
  • siRNA

    GCAUAGUUCAGCUUAGGCAtt

    CAAGUCUAAUAACACUAUUtt

    GCUAAGAACAUGGACUAUAtt

    GGUGCUAGGUGGUUACAUUtt

    CAUGCUCACUCAGACUAUAtt

    CUGACUUAGUAGGAAGUUAtt

    CAGUGUUCAUGACUUAAUUtt

    GGCUUAAUUUGAACUAUUAtt

    CAAAUAAGAUGGGCAAAUAtt

    CUAAGGAGCUUAUAAAGUAtt

    CAUCUAACCAUCGAAAUAAtt

    CCUGUAGACAUGACAUAUAtt

    CUGAUAGCGUGGAAGAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CEP85L(NM_206921) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens centrosomal protein 85 like (CEP85L), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1491
  • Annotation
    This variant (2) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (b) has a shorter and distinct C-terminus compared to isoform a.
  • siRNA

    CAUCUAACCAUCGAAAUAAtt

    CCUGUAGACAUGACAUAUAtt

    CUGAUAGCGUGGAAGAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CEP85L(NM_001178035) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens centrosomal protein 85 like (CEP85L), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    2427
  • Annotation
    This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (c) has a longer and distinct N-terminus compared to isoform a.
  • siRNA

    GCAUAGUUCAGCUUAGGCAtt

    CAAGUCUAAUAACACUAUUtt

    GCUAAGAACAUGGACUAUAtt

    GGUGCUAGGUGGUUACAUUtt

    CAUGCUCACUCAGACUAUAtt

    CUGACUUAGUAGGAAGUUAtt

    CAGUGUUCAUGACUUAAUUtt

    GGCUUAAUUUGAACUAUUAtt

    CAAAUAAGAUGGGCAAAUAtt

    CUAAGGAGCUUAUAAAGUAtt

    CAUCUAACCAUCGAAAUAAtt

    CCUGUAGACAUGACAUAUAtt

    CUGAUAGCGUGGAAGAUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CEP85L(XM_005266972) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens centrosomal protein 85 like (CEP85L), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    1332
  • siRNA

    GCAUAGUUCAGCUUAGGCAtt

    CAAGUCUAAUAACACUAUUtt

    GCUAAGAACAUGGACUAUAtt

    GGUGCUAGGUGGUUACAUUtt

    CAUGCUCACUCAGACUAUAtt

    CUGACUUAGUAGGAAGUUAtt

    CAGUGUUCAUGACUUAAUUtt

    GGCUUAAUUUGAACUAUUAtt

    CAAAUAAGAUGGGCAAAUAtt

    CUAAGGAGCUUAUAAAGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CEP85L(NM_001042475) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens centrosomal protein 85 like (CEP85L), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2418
  • Annotation
    This variant (1) represents the longest transcript.
  • siRNA

    GCAUAGUUCAGCUUAGGCAtt

    CAAGUCUAAUAACACUAUUtt

    GCUAAGAACAUGGACUAUAtt

    GGUGCUAGGUGGUUACAUUtt

    CAUGCUCACUCAGACUAUAtt

    CUGACUUAGUAGGAAGUUAtt

    CAGUGUUCAUGACUUAAUUtt

    GGCUUAAUUUGAACUAUUAtt

    CAAAUAAGAUGGGCAAAUAtt

    CUAAGGAGCUUAUAAAGUAtt

    CAUCUAACCAUCGAAAUAAtt

    CCUGUAGACAUGACAUAUAtt

    CUGAUAGCGUGGAAGAUCAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"