• Cnot2 Mouse  cDNA/ORF Clone

Cnot2 Mouse cDNA/ORF Clone

Cat.#: 705392-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 278.2 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    CCR4-NOT transcription complex, subunit 2
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Cnot2
  • Gene Type
    protein coding
  • Also Known as
    C79650; AA537049; AA959607; AW557563; 2600016M12Rik; 2810470K03Rik
  • Encoded Protein Alias
    CCR4-NOT transcription complex subunit 2; CCR4-associated factor 2
  • Product Name
    Cnot2(NM_001037846) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus CCR4-NOT transcription complex, subunit 2 (Cnot2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1623
  • Annotation
    This variant (1) represents the longest transcript and encodes isoform a.
  • siRNA

    CACUAUUGGUAAUAAAAGAtt

    CACUAUUGGUAAUAAAAGAtt

    CACUAUUGGUAAUAAAAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Cnot2(NM_001037847) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus CCR4-NOT transcription complex, subunit 2 (Cnot2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1653
  • Annotation
    This variant (2) uses an alternate splice site in its 5' coding region and uses an upstream translation start codon, compared to variant 1. The resulting isoform (d) is longer at the N-terminus, compared to isoform a.
  • siRNA

    CACUAUUGGUAAUAAAAGAtt

    CACUAUUGGUAAUAAAAGAtt

    CACUAUUGGUAAUAAAAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Cnot2(NM_001037848) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus CCR4-NOT transcription complex, subunit 2 (Cnot2), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    330
  • Annotation
    This variant (4) differs in the 3' UTR, lacks several exons in the 3' coding region, and includes an alternate terminal exon, compared to variant 1. The resulting isoform (c) has a distinct C-terminus and is shorter than isoform a.
  • siRNA

    GACUGAGUGUAAUAACUUAtt

    GAGCUUCAAUUUUUAAGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Cnot2(NM_028082) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus CCR4-NOT transcription complex, subunit 2 (Cnot2), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1500
  • Annotation
    This variant (3) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1, resulting in an isoform (b) that is shorter than isoform 1.
  • siRNA

    CACUAUUGGUAAUAAAAGAtt

    CACUAUUGGUAAUAAAAGAtt

    CACUAUUGGUAAUAAAAGAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"