• CRAT Human  cDNA/ORF Clone

CRAT Human cDNA/ORF Clone

Cat.#: 717106-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 322.9 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    carnitine O-acetyltransferase
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CRAT
  • Gene Type
    protein coding
  • Also Known as
    CAT; CAT1
  • Encoded Protein Alias
    CAT; carnitine acetylase; carnitine acetyltransferase
  • Product Name
    CRAT(XM_017014275) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens carnitine O-acetyltransferase (CRAT), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1884
  • siRNA

    GAGAAGAUCUGGAACUCAUtt

    GGGUCUCAGAAGACGUGUAtt

    UCUUCACCGUGUGCCUAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CRAT(XM_017014274) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens carnitine O-acetyltransferase (CRAT), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1884
  • siRNA

    CGAUCUUCGCAGAUUCUGAtt

    GGGCUGUGGUGUAACCUCAtt

    AGGCAGUCUCUGUCCUCCAtt

    GAGAAGAUCUGGAACUCAUtt

    GGGUCUCAGAAGACGUGUAtt

    UCUUCACCGUGUGCCUAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CRAT(NM_000755) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens carnitine O-acetyltransferase (CRAT), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1881
  • Annotation
    This variant (1) encodes isoform 1.
  • siRNA

    GAGAAGAUCUGGAACUCAUtt

    GGGUCUCAGAAGACGUGUAtt

    UCUUCACCGUGUGCCUAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CRAT(NM_001346547) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens carnitine O-acetyltransferase (CRAT), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    1809
  • Annotation
    This variant (4) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (4) is shorter than isoform 1.
  • siRNA
  • DataSheet:
  • FAQs:
  • Product Name
    CRAT(NM_001346549) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens carnitine O-acetyltransferase (CRAT), transcript variant 7, mRNA.
  • Synonyms
  • ORF length
    1761
  • Annotation
    This variant (7) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The encoded isoform (6) is shorter than isoform 1.
  • siRNA
  • DataSheet:
  • FAQs:
  • Product Name
    CRAT(NM_001346546) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens carnitine O-acetyltransferase (CRAT), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1884
  • Annotation
    This variant (3) contains an alternate exon in the 5' region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (3) is longer and has a distinct N-terminus, compared to isoform 1.
  • siRNA
  • DataSheet:
  • FAQs:
  • Product Name
    CRAT(NM_001346548) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens carnitine O-acetyltransferase (CRAT), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    1746
  • Annotation
    This variant (5) contains an alternate exon in the 5' region, initiates translation at a downstream start codon, and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (5) is shorter than isoform 1.
  • siRNA
  • DataSheet:
  • FAQs:
  • Product Name
    CRAT(NM_004003) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens carnitine O-acetyltransferase (CRAT), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1818
  • Annotation
    This variant (2) contains an alternate exon in the 5' region and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) is shorter at the N-terminus, compared to isoform 1. Variants 2 and 6 encode the same protein.
  • siRNA
  • DataSheet:
  • FAQs:
  • Product Name
    CRAT(XM_005251708) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens carnitine O-acetyltransferase (CRAT), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1818
  • siRNA

    CGAUCUUCGCAGAUUCUGAtt

    GGGCUGUGGUGUAACCUCAtt

    AGGCAGUCUCUGUCCUCCAtt

    GAGAAGAUCUGGAACUCAUtt

    GGGUCUCAGAAGACGUGUAtt

    UCUUCACCGUGUGCCUAGAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"