Cart 2
  • Creb1 Mouse  cDNA/ORF Clone

Creb1 Mouse cDNA/ORF Clone

Cat.#: 709642-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    cAMP responsive element binding protein 1
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Creb1
  • Gene Type
    protein coding
  • Also Known as
    Creb; Creb-1; AV083133; 2310001E10Rik; 3526402H21Rik
  • Encoded Protein Alias
    cyclic AMP-responsive element-binding protein 1; cAMP-responsive element-binding protein 1
  • Product Name
    Creb1(NM_001037726) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus cAMP responsive element binding protein 1 (Creb1), transcript variant C, mRNA.
  • Synonyms
  • ORF length
    864
  • Annotation
    This variant (C) lacks an alternate in-frame exon in the 5' coding region and uses a downstream start codon, compared to variant A. The encoded protein (isoform C) has a shorter N-terminus, compared to isoform A.
  • siRNA

    GGCAGUGCUUGAAAACCAAtt

    GCAGUGCUUGAAAACCAAAtt

    CCAAGUUGUUGUUCAAGCUtt

    GGCUAACAAUGGUACGGAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    Creb1(NM_009952) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus cAMP responsive element binding protein 1 (Creb1), transcript variant B, mRNA.
  • Synonyms
  • ORF length
    1026
  • Annotation
    This variant (B) includes an alternate in-frame exon in the 5' coding region, compared to variant A, resulting in a longer protein (isoform B), compared to isoform A.
  • siRNA

    GGCAGUGCUUGAAAACCAAtt

    GCAGUGCUUGAAAACCAAAtt

    GAGAUGCUGCUGUAACAGAtt

    CCAAGUUGUUGUUCAAGCUtt

    GGCUAACAAUGGUACGGAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    Creb1(NM_133828) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus cAMP responsive element binding protein 1 (Creb1), transcript variant A, mRNA.
  • Synonyms
  • ORF length
    984
  • Annotation
    This variant (A) encodes isoform A.
  • siRNA

    GGCAGUGCUUGAAAACCAAtt

    GCAGUGCUUGAAAACCAAAtt

    GAGAUGCUGCUGUAACAGAtt

    CCAAGUUGUUGUUCAAGCUtt

    GGCUAACAAUGGUACGGAUtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"