NovoPro
Cart 2
  • Cdh1 Rat  cDNA/ORF Clones

Cdh1 Rat cDNA/ORF Clones

Cat.#: 704198-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 281.8 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    cadherin 1
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Cdh1
  • Gene Type
    protein coding
  • Encoded Protein Alias
    cadherin-1; E-cadherin; epithelial cadherin; uvomorulin
  • Product Name
    Cdh1(NM_031334) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus cadherin 1 (Cdh1), mRNA.
  • Synonyms
  • ORF length
    2661
  • siRNA

    CUACGAUUAUCUGAACGAAtt

    GGGACAAAGAGACAACGGUtt

    GAAGAUCACGUAUCGGAUUtt

  • DataSheet:
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"