NovoPro
Cart 2
  • C10orf76 Human  cDNA/ORF Clone

C10orf76 Human cDNA/ORF Clone

Cat.#: 744459-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 318.8 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    chromosome 10 open reading frame 76
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    C10orf76
  • Gene Type
    protein coding
  • Encoded Protein Alias
    UPF0668 protein C10orf76
  • Product Name
    C10orf76(XM_011540152) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens chromosome 10 open reading frame 76 (C10orf76), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    2004
  • siRNA

    AGUUCCUUAUGUCAAAUGAtt

    CCUUAUGAUUGUGAACCUAtt

    CGCUGCUGUGAAUCACAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C10orf76(XM_011540157) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens chromosome 10 open reading frame 76 (C10orf76), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    1917
  • siRNA

    AGUUCCUUAUGUCAAAUGAtt

    CCUUAUGAUUGUGAACCUAtt

    CGCUGCUGUGAAUCACAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C10orf76(XM_011540153) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens chromosome 10 open reading frame 76 (C10orf76), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1968
  • siRNA

    AGUUCCUUAUGUCAAAUGAtt

    CCUUAUGAUUGUGAACCUAtt

    CGCUGCUGUGAAUCACAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C10orf76(XM_011540154) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens chromosome 10 open reading frame 76 (C10orf76), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    1902
  • siRNA

    AGUUCCUUAUGUCAAAUGAtt

    CCUUAUGAUUGUGAACCUAtt

    CGCUGCUGUGAAUCACAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C10orf76(XM_017016635) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens chromosome 10 open reading frame 76 (C10orf76), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1980
  • siRNA

    AGUUCCUUAUGUCAAAUGAtt

    CCUUAUGAUUGUGAACCUAtt

    CGCUGCUGUGAAUCACAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C10orf76(XM_011540156) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens chromosome 10 open reading frame 76 (C10orf76), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    1548
  • siRNA

    AGUUCCUUAUGUCAAAUGAtt

    CCUUAUGAUUGUGAACCUAtt

    CGCUGCUGUGAAUCACAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    C10orf76(XM_017016636) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens chromosome 10 open reading frame 76 (C10orf76), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    1911
  • siRNA

    AGUUCCUUAUGUCAAAUGAtt

    CCUUAUGAUUGUGAACCUAtt

    CGCUGCUGUGAAUCACAUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"