Cart 2
  • BMP6 Human  cDNA/ORF Clone

BMP6 Human cDNA/ORF Clone

Cat.#: 714886-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 264.3 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    bone morphogenetic protein 6
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    BMP6
  • Gene Type
    protein coding
  • Also Known as
    VGR; VGR1
  • Encoded Protein Alias
    bone morphogenetic protein 6; BMP-6; VG-1-R; VG-1-related protein; VGR-1; Vg1-related sequence; vegetal related growth factor (TGFB-related); vegetal-related (TGFB related) cytokine
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"