Cart 2
  • MAP4K2 Human  cDNA/ORF Clone

MAP4K2 Human cDNA/ORF Clone

Cat.#: 717512-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 395.4 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    mitogen-activated protein kinase kinase kinase kinase 2
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    MAP4K2
  • Gene Type
    protein coding
  • Also Known as
    GCK; BL44; RAB8IP
  • Encoded Protein Alias
    B lymphocyte serine/threonine protein kinase; MAPK/ERK kinase kinase kinase 2; MEK kinase kinase 2; MEKKK 2; Rab8 interacting protein; germinal centre kinase (GC kinase)
  • Product Name
    MAP4K2(XM_017018093) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase kinase 2 (MAP4K2), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    2307
  • siRNA

    CCAAGAUUCCUGACACCAAtt

    CCUAUGACAUGUUUCCAGAtt

    GCAGCUACCUCAGGAAUGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MAP4K2(XM_011545203) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase kinase 2 (MAP4K2), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2394
  • siRNA

    CCAAGAUUCCUGACACCAAtt

    CCUAUGACAUGUUUCCAGAtt

    GCAGCUACCUCAGGAAUGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MAP4K2(XM_017018095) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase kinase 2 (MAP4K2), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    1863
  • siRNA

    CCAAGAUUCCUGACACCAAtt

    CCUAUGACAUGUUUCCAGAtt

    GCAGCUACCUCAGGAAUGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MAP4K2(NM_001307990) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens mitogen-activated protein kinase kinase kinase kinase 2 (MAP4K2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2439
  • Annotation
    This variant (2) uses an alternate in-frame splice site at an internal exon compared to variant 1. It encodes isoform 2, which is shorter than isoform 1.
  • siRNA

    CCAAGAUUCCUGACACCAAtt

    CCUAUGACAUGUUUCCAGAtt

    GCAGCUACCUCAGGAAUGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MAP4K2(XM_017018094) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase kinase 2 (MAP4K2), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1932
  • siRNA

    CCAAGAUUCCUGACACCAAtt

    CCUAUGACAUGUUUCCAGAtt

    GCAGCUACCUCAGGAAUGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MAP4K2(XM_017018096) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase kinase 2 (MAP4K2), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    1755
  • siRNA

    CCUAUGACAUGUUUCCAGAtt

    GCAGCUACCUCAGGAAUGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MAP4K2(XM_011545204) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase kinase 2 (MAP4K2), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    2331
  • siRNA

    CCAAGAUUCCUGACACCAAtt

    CCUAUGACAUGUUUCCAGAtt

    GCAGCUACCUCAGGAAUGAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"