• ATG4A Human  cDNA/ORF Clone

ATG4A Human cDNA/ORF Clone

Cat.#: 703004-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    autophagy related 4A cysteine peptidase
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    ATG4A
  • Gene Type
    protein coding
  • Also Known as
    APG4A; AUTL2
  • Encoded Protein Alias
    cysteine protease ATG4A; APG4 autophagy 4 homolog A; ATG4 autophagy related 4 homolog A; AUT-like 2 cysteine endopeptidase; AUT-like 2, cysteine endopeptidase; autophagin 2; autophagin-2; autophagy-related cysteine endopeptidase 2; autophagy-related protein 4 homolog A; hAPG4A
  • Product Name
    ATG4A(NM_001321290) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens autophagy related 4A cysteine peptidase (ATG4A), transcript variant 7, mRNA.
  • Synonyms
  • ORF length
    681
  • siRNA

    GGAUCUUAGGGAAGCAGCAtt

    GGGAUUUUUCUGCAAAGAAtt

    GCUGUUGUCUGAUAUAAGUtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATG4A(NM_052936) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens autophagy related 4A cysteine peptidase (ATG4A), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1197
  • Annotation
    This variant (1) encodes isoform (a).
  • siRNA

    GGAUCUUAGGGAAGCAGCAtt

    GGGAUUUUUCUGCAAAGAAtt

    GCUGUUGUCUGAUAUAAGUtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATG4A(XM_011530841) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens autophagy related 4A cysteine peptidase (ATG4A), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1023
  • siRNA

    GGAUCUUAGGGAAGCAGCAtt

    GGGAUUUUUCUGCAAAGAAtt

    GCUGUUGUCUGAUAUAAGUtt

  • DataSheet:
  • FAQs:
  • Product Name
    ATG4A(NM_178270) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens autophagy related 4A cysteine peptidase (ATG4A), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1011
  • Annotation
    This variant (2) encodes isoform b.
  • siRNA

    GGAUCUUAGGGAAGCAGCAtt

    GGGAUUUUUCUGCAAAGAAtt

    GCUGUUGUCUGAUAUAAGUtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"