NovoPro
Cart 2
  • Atp6v1e1 Mouse  cDNA/ORF Clone

Atp6v1e1 Mouse cDNA/ORF Clone

Cat.#: 710061-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 140.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    ATPase, H+ transporting, lysosomal V1 subunit E1
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Atp6v1e1
  • Gene Type
    protein coding
  • Also Known as
    E2; P31; Vma4; Atp6e; Atp6e2; Atp6v1e; D6Ertd385e; 2410029D23Rik
  • Encoded Protein Alias
    V-type proton ATPase subunit E 1; ATPase, H+ transporting lysosomal (vacuolar proton pump), 32 kDa; ATPase, H+ transporting, V1 subunit E; ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E; H(+)-ATPase E-like protein; H+ ATPase subunit E; V-ATPase 31 kDa subunit; V-ATPase subunit E 1; VATPase, H+ transporting, lysosomal V1 subunit E1; lysosomal 31kDa; vacuolar proton pump subunit E 1
  • Product Name
    Atp6v1e1(NM_007510) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus ATPase, H+ transporting, lysosomal V1 subunit E1 (Atp6v1e1), mRNA.
  • Synonyms
    XM_359325  
  • ORF length
    681
  • siRNA

    GACUGAAGAUUAUGGAAUAtt

    GGGAUGACCUCAUCACUGAtt

    GCAAUCCCUAUGUAUAAAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"