NovoPro
Cart 2
  • Atp6v1e1 Rat  cDNA/ORF Clone

Atp6v1e1 Rat cDNA/ORF Clone

Cat.#: 737682-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    ATPase H+ transporting V1 subunit E1
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Atp6v1e1
  • Gene Type
    protein coding
  • Also Known as
    P31; Vma4; Atp6e; Atp6e2
  • Encoded Protein Alias
    ATPase, H+ transporting, V1 subunit E; ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E; ATPase, H+ transporting, lysosomal V1 subunit E1; V-ATPase subunit E 1; VATPase, H+ transporting, lysosomal V1 subunit E1; vacuolar H(+)-ATPase, E subunit; vacuolar H+ ATPase E1; vacuolar proton pump subunit E 1
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"