• Sptssb Mouse  cDNA/ORF Clone

Sptssb Mouse cDNA/ORF Clone

Cat.#: 715364-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 5-8 days
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    serine palmitoyltransferase, small subunit B
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Sptssb
  • Gene Type
    protein coding
  • Also Known as
    ADMP; Sssptb; 1110032A04Rik
  • Encoded Protein Alias
    androgen down regulated in mouse prostate; small subunit of serine palmitoyltransferase B
  • Product Name
    Sptssb(NM_001286959) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus serine palmitoyltransferase, small subunit B (Sptssb), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    186
  • Annotation
    This variant (3) differs in the 5' UTR and has a different 3' structure which results in a frameshift compared to variant 1. The resulting isoform (b) has a distinct C-terminus and is shorter than isoform a.
  • siRNA

    GGAAAUAGCUAAUACCUAAtt

    UAUCAAUACCAGAUCAUCAtt

    CUCUAUUAUCAAUACCAGAtt

    CAAUCGAUGCUCAACACCAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"