Cart 2
  • AK4 Human  cDNA/ORF Clone

AK4 Human cDNA/ORF Clone

Cat.#: 714673-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    adenylate kinase 4
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    AK4
  • Gene Type
    protein coding
  • Also Known as
    AK3; AK 4; AK3L1; AK3L2
  • Encoded Protein Alias
    adenylate kinase 4, mitochondrial; AK 4; AK4; ATP-AMP transphosphorylase; GTP:AMP phosphotransferase AK4, mitochondrial; adenylate kinase 3-like 1; adenylate kinase isoenzyme 4, mitochondrial; mitochondrial adenylate kinase-3; nucleoside-triphosphate-adenylate kinase
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTB7
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    1815
  • Vector Type
    Cloning Vector
  • Promoter
    -
  • Antibiotic Resistance
    Chloramphenicol
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Gateway® or compatible clone with M13 forward and M13 reverse primers. Chloramphenicol resistance in bacteria.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"